Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633591_at:

>probe:Drosophila_2:1633591_at:373:561; Interrogation_Position=1620; Antisense; GGAACCGGAGTTCATCAACTACTCG
>probe:Drosophila_2:1633591_at:256:193; Interrogation_Position=1636; Antisense; AACTACTCGCAGATCAAGCATTTGG
>probe:Drosophila_2:1633591_at:533:427; Interrogation_Position=1681; Antisense; GAGATCAGCTGCAAGGCCGAACCGG
>probe:Drosophila_2:1633591_at:492:13; Interrogation_Position=1714; Antisense; ATTAAGTACAATGCCACCGTGGAGA
>probe:Drosophila_2:1633591_at:120:411; Interrogation_Position=1737; Antisense; GACGCAGCCGTATGTGGAGGACAAC
>probe:Drosophila_2:1633591_at:112:549; Interrogation_Position=1752; Antisense; GGAGGACAACTACGATTACTACTAT
>probe:Drosophila_2:1633591_at:202:459; Interrogation_Position=1765; Antisense; GATTACTACTATAGCCCCAAGGCGG
>probe:Drosophila_2:1633591_at:200:399; Interrogation_Position=1854; Antisense; GACAGCGGGACATCACTACTACGAG
>probe:Drosophila_2:1633591_at:627:549; Interrogation_Position=1897; Antisense; GGAGTCAGCTATTTCGACACAGGAA
>probe:Drosophila_2:1633591_at:667:153; Interrogation_Position=1915; Antisense; ACAGGAACTACTACGGCACCAGGAA
>probe:Drosophila_2:1633591_at:381:669; Interrogation_Position=1941; Antisense; TACTGCAACCGGAAATGGCCTGGAA
>probe:Drosophila_2:1633591_at:385:585; Interrogation_Position=1961; Antisense; TGGAAGTCGGATACGGCGGCTACTA
>probe:Drosophila_2:1633591_at:94:671; Interrogation_Position=1984; Antisense; TACGATCACTACACCAGCTACGAGC
>probe:Drosophila_2:1633591_at:373:115; Interrogation_Position=2022; Antisense; AGCAGGTGGATTTGCCACTGCCGGA

Paste this into a BLAST search page for me
GGAACCGGAGTTCATCAACTACTCGAACTACTCGCAGATCAAGCATTTGGGAGATCAGCTGCAAGGCCGAACCGGATTAAGTACAATGCCACCGTGGAGAGACGCAGCCGTATGTGGAGGACAACGGAGGACAACTACGATTACTACTATGATTACTACTATAGCCCCAAGGCGGGACAGCGGGACATCACTACTACGAGGGAGTCAGCTATTTCGACACAGGAAACAGGAACTACTACGGCACCAGGAATACTGCAACCGGAAATGGCCTGGAATGGAAGTCGGATACGGCGGCTACTATACGATCACTACACCAGCTACGAGCAGCAGGTGGATTTGCCACTGCCGGA

Full Affymetrix probeset data:

Annotations for 1633591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime