Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633592_a_at:

>probe:Drosophila_2:1633592_a_at:83:79; Interrogation_Position=329; Antisense; AGGTCCACTGGACGTATTCGATTCC
>probe:Drosophila_2:1633592_a_at:184:5; Interrogation_Position=344; Antisense; ATTCGATTCCTGCTAACCGATTTGG
>probe:Drosophila_2:1633592_a_at:670:459; Interrogation_Position=362; Antisense; GATTTGGACTTCACTGGTCCCGACT
>probe:Drosophila_2:1633592_a_at:6:75; Interrogation_Position=393; Antisense; AGGACAACAAGGTCACACTCCTGTT
>probe:Drosophila_2:1633592_a_at:233:603; Interrogation_Position=414; Antisense; TGTTCAGTGACGAGCAGACCCTAAG
>probe:Drosophila_2:1633592_a_at:160:561; Interrogation_Position=452; Antisense; GGAAAGGATCCCATGGAGCCTACAT
>probe:Drosophila_2:1633592_a_at:203:63; Interrogation_Position=475; Antisense; ATGTGCCCGTTCCATGATCAGTGGA
>probe:Drosophila_2:1633592_a_at:509:117; Interrogation_Position=592; Antisense; AGCTCACAATTTCTACCTTTGCGAA
>probe:Drosophila_2:1633592_a_at:333:363; Interrogation_Position=627; Antisense; GCAATATCTTTGTTCTGGACTTCTA
>probe:Drosophila_2:1633592_a_at:668:535; Interrogation_Position=656; Antisense; GGTCCTCATAAAGTGAGCGCCTCTG
>probe:Drosophila_2:1633592_a_at:455:315; Interrogation_Position=674; Antisense; GCCTCTGACTATTACGCTGTTTCGA
>probe:Drosophila_2:1633592_a_at:608:479; Interrogation_Position=692; Antisense; GTTTCGAATTGATGAACTCCTCCAA
>probe:Drosophila_2:1633592_a_at:550:183; Interrogation_Position=715; Antisense; AAAAGCAATCCAACTGACGCCTCAT
>probe:Drosophila_2:1633592_a_at:298:313; Interrogation_Position=828; Antisense; GCCACTTATCAGTTGAGCTCTGTGA

Paste this into a BLAST search page for me
AGGTCCACTGGACGTATTCGATTCCATTCGATTCCTGCTAACCGATTTGGGATTTGGACTTCACTGGTCCCGACTAGGACAACAAGGTCACACTCCTGTTTGTTCAGTGACGAGCAGACCCTAAGGGAAAGGATCCCATGGAGCCTACATATGTGCCCGTTCCATGATCAGTGGAAGCTCACAATTTCTACCTTTGCGAAGCAATATCTTTGTTCTGGACTTCTAGGTCCTCATAAAGTGAGCGCCTCTGGCCTCTGACTATTACGCTGTTTCGAGTTTCGAATTGATGAACTCCTCCAAAAAAGCAATCCAACTGACGCCTCATGCCACTTATCAGTTGAGCTCTGTGA

Full Affymetrix probeset data:

Annotations for 1633592_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime