Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633593_s_at:

>probe:Drosophila_2:1633593_s_at:527:325; Interrogation_Position=147; Antisense; GCTGTCGTACAAGGGTCGCGTGCTA
>probe:Drosophila_2:1633593_s_at:520:635; Interrogation_Position=162; Antisense; TCGCGTGCTATCCAATCAGAGCGTA
>probe:Drosophila_2:1633593_s_at:419:405; Interrogation_Position=246; Antisense; GACGGCCAATCAGAGCAGCAAGTTA
>probe:Drosophila_2:1633593_s_at:566:359; Interrogation_Position=336; Antisense; GCAACGCGAAGAATATCCTGGTGGC
>probe:Drosophila_2:1633593_s_at:351:493; Interrogation_Position=364; Antisense; GTCAATCCACCGGACGACGAAAGTC
>probe:Drosophila_2:1633593_s_at:169:179; Interrogation_Position=393; Antisense; AAACTTCAACGCAGGTGACGATGAT
>probe:Drosophila_2:1633593_s_at:234:59; Interrogation_Position=416; Antisense; ATGATGCACTGGAGGCCCAGGACAT
>probe:Drosophila_2:1633593_s_at:383:267; Interrogation_Position=433; Antisense; CAGGACATGACTGGACACGATTTGT
>probe:Drosophila_2:1633593_s_at:716:459; Interrogation_Position=451; Antisense; GATTTGTCCTCAATTCAAACCGATG
>probe:Drosophila_2:1633593_s_at:392:461; Interrogation_Position=475; Antisense; GATTTATCGCTCAAAGGCCAGACGG
>probe:Drosophila_2:1633593_s_at:237:263; Interrogation_Position=493; Antisense; CAGACGGAACCGGAGCTGGATTGCT
>probe:Drosophila_2:1633593_s_at:460:333; Interrogation_Position=507; Antisense; GCTGGATTGCTCCATTGGATCTCAT
>probe:Drosophila_2:1633593_s_at:277:39; Interrogation_Position=525; Antisense; ATCTCATGGATTCTCTGGATCTCAA
>probe:Drosophila_2:1633593_s_at:193:413; Interrogation_Position=57; Antisense; GACCGTCTACGAGGTGGATCGCTTA

Paste this into a BLAST search page for me
GCTGTCGTACAAGGGTCGCGTGCTATCGCGTGCTATCCAATCAGAGCGTAGACGGCCAATCAGAGCAGCAAGTTAGCAACGCGAAGAATATCCTGGTGGCGTCAATCCACCGGACGACGAAAGTCAAACTTCAACGCAGGTGACGATGATATGATGCACTGGAGGCCCAGGACATCAGGACATGACTGGACACGATTTGTGATTTGTCCTCAATTCAAACCGATGGATTTATCGCTCAAAGGCCAGACGGCAGACGGAACCGGAGCTGGATTGCTGCTGGATTGCTCCATTGGATCTCATATCTCATGGATTCTCTGGATCTCAAGACCGTCTACGAGGTGGATCGCTTA

Full Affymetrix probeset data:

Annotations for 1633593_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime