FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633596_at:

>probe:Drosophila_2:1633596_at:399:177; Interrogation_Position=1042; Antisense; AAACGGGCCATAAGGATGTCCAGGA
>probe:Drosophila_2:1633596_at:44:555; Interrogation_Position=1069; Antisense; GGACCTGTGGCAGCGACTAAAACCG
>probe:Drosophila_2:1633596_at:342:365; Interrogation_Position=1099; Antisense; GAATCAAATGACACCTCAGACGATC
>probe:Drosophila_2:1633596_at:174:337; Interrogation_Position=1158; Antisense; GCTCCTTAAATATCTACACTCAGTG
>probe:Drosophila_2:1633596_at:110:175; Interrogation_Position=1236; Antisense; AAAGCCTCTCGAGATGGATCCCGTA
>probe:Drosophila_2:1633596_at:27:441; Interrogation_Position=1248; Antisense; GATGGATCCCGTACTCTTGGAAGTA
>probe:Drosophila_2:1633596_at:83:235; Interrogation_Position=1306; Antisense; AATGCCATGGATAATTCGGTCAAGG
>probe:Drosophila_2:1633596_at:726:441; Interrogation_Position=1351; Antisense; GATGAGACGTTAATCGCTAACCTAG
>probe:Drosophila_2:1633596_at:61:661; Interrogation_Position=1409; Antisense; TAAAACCGCGAAACCGACCAGCTGA
>probe:Drosophila_2:1633596_at:258:559; Interrogation_Position=891; Antisense; GGAACTATTTTTGCACGAGGAACCT
>probe:Drosophila_2:1633596_at:400:663; Interrogation_Position=915; Antisense; TAAACTGGTTTCGTTTCCCACACAT
>probe:Drosophila_2:1633596_at:106:159; Interrogation_Position=934; Antisense; ACACATTTGTTTCCGACTCCAATGA
>probe:Drosophila_2:1633596_at:379:17; Interrogation_Position=976; Antisense; ATATTCCCACTATCATTTAAGGCGA
>probe:Drosophila_2:1633596_at:560:697; Interrogation_Position=991; Antisense; TTTAAGGCGATTAATGTTCTGCCCC

Paste this into a BLAST search page for me
AAACGGGCCATAAGGATGTCCAGGAGGACCTGTGGCAGCGACTAAAACCGGAATCAAATGACACCTCAGACGATCGCTCCTTAAATATCTACACTCAGTGAAAGCCTCTCGAGATGGATCCCGTAGATGGATCCCGTACTCTTGGAAGTAAATGCCATGGATAATTCGGTCAAGGGATGAGACGTTAATCGCTAACCTAGTAAAACCGCGAAACCGACCAGCTGAGGAACTATTTTTGCACGAGGAACCTTAAACTGGTTTCGTTTCCCACACATACACATTTGTTTCCGACTCCAATGAATATTCCCACTATCATTTAAGGCGATTTAAGGCGATTAATGTTCTGCCCC

Full Affymetrix probeset data:

Annotations for 1633596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720