FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633597_at:

>probe:Drosophila_2:1633597_at:247:167; Interrogation_Position=508; Antisense; AAATGACATTGGCTCTGACCCTGTA
>probe:Drosophila_2:1633597_at:119:611; Interrogation_Position=523; Antisense; TGACCCTGTACTCGTGCATCTTTAT
>probe:Drosophila_2:1633597_at:550:51; Interrogation_Position=546; Antisense; ATGCGATTTGCCTACAAGGTCCAGC
>probe:Drosophila_2:1633597_at:243:343; Interrogation_Position=637; Antisense; GCTTCCTTCACTACAATTACGGGTC
>probe:Drosophila_2:1633597_at:627:13; Interrogation_Position=652; Antisense; ATTACGGGTCTAAGGAGCAGCAGGC
>probe:Drosophila_2:1633597_at:527:491; Interrogation_Position=677; Antisense; GTAAATGTAATCCTTGCCCCGAAAT
>probe:Drosophila_2:1633597_at:188:411; Interrogation_Position=719; Antisense; GACGCGCGAAGCCACTTCAAATGTT
>probe:Drosophila_2:1633597_at:540:263; Interrogation_Position=751; Antisense; CAGCAGCAGCTATCGCAATTTACTG
>probe:Drosophila_2:1633597_at:246:453; Interrogation_Position=793; Antisense; GATCTAGCAAATTGCACTGCCGCAA
>probe:Drosophila_2:1633597_at:715:235; Interrogation_Position=873; Antisense; AATCGGCTGAATCTCGAATCGCGAA
>probe:Drosophila_2:1633597_at:518:367; Interrogation_Position=888; Antisense; GAATCGCGAAGTTGTCGTGCCCCAG
>probe:Drosophila_2:1633597_at:363:247; Interrogation_Position=946; Antisense; AATTGAGTCTATACCCAACTTGTTA
>probe:Drosophila_2:1633597_at:557:309; Interrogation_Position=960; Antisense; CCAACTTGTTACTTTGCCCATTTAG
>probe:Drosophila_2:1633597_at:232:473; Interrogation_Position=984; Antisense; GTTAATTCCGTTAGGCAGTTGATCA

Paste this into a BLAST search page for me
AAATGACATTGGCTCTGACCCTGTATGACCCTGTACTCGTGCATCTTTATATGCGATTTGCCTACAAGGTCCAGCGCTTCCTTCACTACAATTACGGGTCATTACGGGTCTAAGGAGCAGCAGGCGTAAATGTAATCCTTGCCCCGAAATGACGCGCGAAGCCACTTCAAATGTTCAGCAGCAGCTATCGCAATTTACTGGATCTAGCAAATTGCACTGCCGCAAAATCGGCTGAATCTCGAATCGCGAAGAATCGCGAAGTTGTCGTGCCCCAGAATTGAGTCTATACCCAACTTGTTACCAACTTGTTACTTTGCCCATTTAGGTTAATTCCGTTAGGCAGTTGATCA

Full Affymetrix probeset data:

Annotations for 1633597_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720