FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633598_at:

>probe:Drosophila_2:1633598_at:491:619; Interrogation_Position=1074; Antisense; TGCTTTGAAGTGTCTCCGGTGGCTG
>probe:Drosophila_2:1633598_at:329:359; Interrogation_Position=1103; Antisense; GCAAGCCTCGTGACGATCTGTGTGT
>probe:Drosophila_2:1633598_at:310:41; Interrogation_Position=1118; Antisense; ATCTGTGTGTTCACCACTTGGCGAA
>probe:Drosophila_2:1633598_at:730:499; Interrogation_Position=1148; Antisense; GTCGATTAGAGTGCCTTTCCATACA
>probe:Drosophila_2:1633598_at:500:695; Interrogation_Position=1163; Antisense; TTTCCATACAGTCCGCTCGTGAGAT
>probe:Drosophila_2:1633598_at:616:185; Interrogation_Position=1219; Antisense; AACAATGAGCGCCTTCGGTATCTGA
>probe:Drosophila_2:1633598_at:571:385; Interrogation_Position=1242; Antisense; GAACATTTGCTATTGCCTGGGCATC
>probe:Drosophila_2:1633598_at:31:559; Interrogation_Position=1284; Antisense; GGACACGCTGGCCAGCTTATCGAAA
>probe:Drosophila_2:1633598_at:58:177; Interrogation_Position=1322; Antisense; AAACCCTAGAGCTATTTGCCGCGGC
>probe:Drosophila_2:1633598_at:690:611; Interrogation_Position=1362; Antisense; TGACATCATGGAACGGCTACCGCAC
>probe:Drosophila_2:1633598_at:35:559; Interrogation_Position=1447; Antisense; GGACACTTTTATGCCGATGAGCCGG
>probe:Drosophila_2:1633598_at:388:443; Interrogation_Position=1462; Antisense; GATGAGCCGGAATTCGATCGCCAAG
>probe:Drosophila_2:1633598_at:187:315; Interrogation_Position=1486; Antisense; GCCTTGTGAGGCCTTATTCGTTTAA
>probe:Drosophila_2:1633598_at:183:297; Interrogation_Position=1569; Antisense; CGCAGCTTTATTCGTGATCTTACCA

Paste this into a BLAST search page for me
TGCTTTGAAGTGTCTCCGGTGGCTGGCAAGCCTCGTGACGATCTGTGTGTATCTGTGTGTTCACCACTTGGCGAAGTCGATTAGAGTGCCTTTCCATACATTTCCATACAGTCCGCTCGTGAGATAACAATGAGCGCCTTCGGTATCTGAGAACATTTGCTATTGCCTGGGCATCGGACACGCTGGCCAGCTTATCGAAAAAACCCTAGAGCTATTTGCCGCGGCTGACATCATGGAACGGCTACCGCACGGACACTTTTATGCCGATGAGCCGGGATGAGCCGGAATTCGATCGCCAAGGCCTTGTGAGGCCTTATTCGTTTAACGCAGCTTTATTCGTGATCTTACCA

Full Affymetrix probeset data:

Annotations for 1633598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720