Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633601_at:

>probe:Drosophila_2:1633601_at:441:705; Interrogation_Position=103; Antisense; TTAGAACCTGTTGGCAGTGTGGCCC
>probe:Drosophila_2:1633601_at:340:65; Interrogation_Position=13; Antisense; ATGGAGGTGTCTGTGGGCACCAAAT
>probe:Drosophila_2:1633601_at:562:587; Interrogation_Position=134; Antisense; TGGATCCCAACGATCGGATCAAGTG
>probe:Drosophila_2:1633601_at:41:545; Interrogation_Position=149; Antisense; GGATCAAGTGGGTCGACAAGCCCAG
>probe:Drosophila_2:1633601_at:522:525; Interrogation_Position=174; Antisense; GGGCAGCTCCCTGAATCTGCTATGT
>probe:Drosophila_2:1633601_at:57:41; Interrogation_Position=188; Antisense; ATCTGCTATGTCCAGCTCAATCCTT
>probe:Drosophila_2:1633601_at:318:49; Interrogation_Position=217; Antisense; ATGCCAAGCGCTCGAACCTGTTGGT
>probe:Drosophila_2:1633601_at:148:519; Interrogation_Position=25; Antisense; GTGGGCACCAAATACGCCATGCAAT
>probe:Drosophila_2:1633601_at:698:163; Interrogation_Position=34; Antisense; AAATACGCCATGCAATGCCCTGGTC
>probe:Drosophila_2:1633601_at:16:51; Interrogation_Position=48; Antisense; ATGCCCTGGTCAGGCATTTCCAGTA
>probe:Drosophila_2:1633601_at:461:71; Interrogation_Position=59; Antisense; AGGCATTTCCAGTACCCATTAACAG
>probe:Drosophila_2:1633601_at:506:89; Interrogation_Position=69; Antisense; AGTACCCATTAACAGGCATATCCAG
>probe:Drosophila_2:1633601_at:646:345; Interrogation_Position=84; Antisense; GCATATCCAGTTCCGGTCGTTAGAA
>probe:Drosophila_2:1633601_at:70:1; Interrogation_Position=94; Antisense; TTCCGGTCGTTAGAACCTGTTGGCA

Paste this into a BLAST search page for me
TTAGAACCTGTTGGCAGTGTGGCCCATGGAGGTGTCTGTGGGCACCAAATTGGATCCCAACGATCGGATCAAGTGGGATCAAGTGGGTCGACAAGCCCAGGGGCAGCTCCCTGAATCTGCTATGTATCTGCTATGTCCAGCTCAATCCTTATGCCAAGCGCTCGAACCTGTTGGTGTGGGCACCAAATACGCCATGCAATAAATACGCCATGCAATGCCCTGGTCATGCCCTGGTCAGGCATTTCCAGTAAGGCATTTCCAGTACCCATTAACAGAGTACCCATTAACAGGCATATCCAGGCATATCCAGTTCCGGTCGTTAGAATTCCGGTCGTTAGAACCTGTTGGCA

Full Affymetrix probeset data:

Annotations for 1633601_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime