FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633602_at:

>probe:Drosophila_2:1633602_at:508:179; Interrogation_Position=241; Antisense; AAACATCATCCGAGGCTGGGAGCGC
>probe:Drosophila_2:1633602_at:196:417; Interrogation_Position=260; Antisense; GAGCGCTATCTGACCTCCAACAAGG
>probe:Drosophila_2:1633602_at:91:581; Interrogation_Position=366; Antisense; TGGCTATATGCAATCCTGAGCGCGC
>probe:Drosophila_2:1633602_at:669:123; Interrogation_Position=384; Antisense; AGCGCGCCAGCGAATCGGATTCCAT
>probe:Drosophila_2:1633602_at:208:105; Interrogation_Position=418; Antisense; AGACTCCAGCGACAATCAGATCTCA
>probe:Drosophila_2:1633602_at:566:239; Interrogation_Position=442; Antisense; AATCAATCAGAACACCACAACGGCC
>probe:Drosophila_2:1633602_at:60:411; Interrogation_Position=503; Antisense; GACGAAAAGGATTCACCCTCGCATC
>probe:Drosophila_2:1633602_at:350:121; Interrogation_Position=548; Antisense; AGCGGAATGGTGTCTGGATCTACGA
>probe:Drosophila_2:1633602_at:517:81; Interrogation_Position=580; Antisense; AGGGAACAAGGATCTCCTCGGCACA
>probe:Drosophila_2:1633602_at:728:565; Interrogation_Position=599; Antisense; GGCACACCCACTTCGAATACAAAGA
>probe:Drosophila_2:1633602_at:383:421; Interrogation_Position=622; Antisense; GAGCAAACTATCCACGAACTCCAGT
>probe:Drosophila_2:1633602_at:31:385; Interrogation_Position=637; Antisense; GAACTCCAGTGCGACAGCGAAGAAA
>probe:Drosophila_2:1633602_at:129:401; Interrogation_Position=687; Antisense; GACATCGATGATAACTGCTACCGTG
>probe:Drosophila_2:1633602_at:278:341; Interrogation_Position=703; Antisense; GCTACCGTGTAATCCGCATCTGATA

Paste this into a BLAST search page for me
AAACATCATCCGAGGCTGGGAGCGCGAGCGCTATCTGACCTCCAACAAGGTGGCTATATGCAATCCTGAGCGCGCAGCGCGCCAGCGAATCGGATTCCATAGACTCCAGCGACAATCAGATCTCAAATCAATCAGAACACCACAACGGCCGACGAAAAGGATTCACCCTCGCATCAGCGGAATGGTGTCTGGATCTACGAAGGGAACAAGGATCTCCTCGGCACAGGCACACCCACTTCGAATACAAAGAGAGCAAACTATCCACGAACTCCAGTGAACTCCAGTGCGACAGCGAAGAAAGACATCGATGATAACTGCTACCGTGGCTACCGTGTAATCCGCATCTGATA

Full Affymetrix probeset data:

Annotations for 1633602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720