FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633604_at:

>probe:Drosophila_2:1633604_at:151:529; Interrogation_Position=1032; Antisense; GGGATCGGCCTTGGTTTGGCATAAT
>probe:Drosophila_2:1633604_at:560:345; Interrogation_Position=1050; Antisense; GCATAATACTGACAACTCCGGCAAT
>probe:Drosophila_2:1633604_at:228:729; Interrogation_Position=1074; Antisense; TTGTGATACCCGAAGCTTGCAGGCC
>probe:Drosophila_2:1633604_at:538:625; Interrogation_Position=1102; Antisense; TGCCCGGTGCTCCTTGGAAATCAAT
>probe:Drosophila_2:1633604_at:220:473; Interrogation_Position=1137; Antisense; GTTAAAGCAGCCCATCGATTCTTCT
>probe:Drosophila_2:1633604_at:283:371; Interrogation_Position=656; Antisense; GAATGGCCCCTGTTAAACTGGAGCA
>probe:Drosophila_2:1633604_at:9:553; Interrogation_Position=675; Antisense; GGAGCAGCTCAACATTGAACCCTTC
>probe:Drosophila_2:1633604_at:148:525; Interrogation_Position=703; Antisense; GGGCTTTTTCATGATGCTATCTCAC
>probe:Drosophila_2:1633604_at:556:557; Interrogation_Position=741; Antisense; GGACTTGTTACATCTCACGGATTCT
>probe:Drosophila_2:1633604_at:527:221; Interrogation_Position=809; Antisense; AAGTGGACACAAATGCCTCTGATCA
>probe:Drosophila_2:1633604_at:163:377; Interrogation_Position=892; Antisense; GAACCACTGACCGTTTCTAACTATG
>probe:Drosophila_2:1633604_at:233:79; Interrogation_Position=929; Antisense; AGGATTTCATCCACTTGGACTGCGA
>probe:Drosophila_2:1633604_at:243:623; Interrogation_Position=949; Antisense; TGCGAGCAGCCCAAACTCAGTGATG
>probe:Drosophila_2:1633604_at:146:169; Interrogation_Position=977; Antisense; AAATGGGTGGCTATGCCTCTTTTCC

Paste this into a BLAST search page for me
GGGATCGGCCTTGGTTTGGCATAATGCATAATACTGACAACTCCGGCAATTTGTGATACCCGAAGCTTGCAGGCCTGCCCGGTGCTCCTTGGAAATCAATGTTAAAGCAGCCCATCGATTCTTCTGAATGGCCCCTGTTAAACTGGAGCAGGAGCAGCTCAACATTGAACCCTTCGGGCTTTTTCATGATGCTATCTCACGGACTTGTTACATCTCACGGATTCTAAGTGGACACAAATGCCTCTGATCAGAACCACTGACCGTTTCTAACTATGAGGATTTCATCCACTTGGACTGCGATGCGAGCAGCCCAAACTCAGTGATGAAATGGGTGGCTATGCCTCTTTTCC

Full Affymetrix probeset data:

Annotations for 1633604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720