FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633605_at:

>probe:Drosophila_2:1633605_at:513:551; Interrogation_Position=1021; Antisense; GGAGAACAACCAGACCATTGACTAT
>probe:Drosophila_2:1633605_at:631:221; Interrogation_Position=1055; Antisense; AAGGGTCTTGGAGCCCATAACTTGC
>probe:Drosophila_2:1633605_at:97:31; Interrogation_Position=1071; Antisense; ATAACTTGCTCATTATTGGCGGAGA
>probe:Drosophila_2:1633605_at:509:265; Interrogation_Position=1108; Antisense; CAGTGAGGAAGCTTACCGTTTCTTA
>probe:Drosophila_2:1633605_at:519:559; Interrogation_Position=1151; Antisense; GGAAAGTGCATCTACATCCCGCTGG
>probe:Drosophila_2:1633605_at:433:287; Interrogation_Position=1172; Antisense; CTGGCAGCTGGCATCGATAGCTTGA
>probe:Drosophila_2:1633605_at:191:725; Interrogation_Position=1193; Antisense; TTGAATGTGGCATCTGCTCTGACGC
>probe:Drosophila_2:1633605_at:218:603; Interrogation_Position=1218; Antisense; TGTTGCTTTTTGAACTGCGCCGAAA
>probe:Drosophila_2:1633605_at:193:389; Interrogation_Position=1239; Antisense; GAAAACTCATTCATCAGGCATCAGA
>probe:Drosophila_2:1633605_at:16:449; Interrogation_Position=863; Antisense; GATCCCTGGGAATCGAAGGCCCTGA
>probe:Drosophila_2:1633605_at:587:573; Interrogation_Position=899; Antisense; GGCGGTCAGTTTAGAGTTCCAATTC
>probe:Drosophila_2:1633605_at:634:491; Interrogation_Position=932; Antisense; GTAACTTGGGATGAGCTCGCGCTAA
>probe:Drosophila_2:1633605_at:85:579; Interrogation_Position=973; Antisense; GGCCGACGACTGTCATGTTTTCATT
>probe:Drosophila_2:1633605_at:280:477; Interrogation_Position=989; Antisense; GTTTTCATTGCCGAGACCAACCAAA

Paste this into a BLAST search page for me
GGAGAACAACCAGACCATTGACTATAAGGGTCTTGGAGCCCATAACTTGCATAACTTGCTCATTATTGGCGGAGACAGTGAGGAAGCTTACCGTTTCTTAGGAAAGTGCATCTACATCCCGCTGGCTGGCAGCTGGCATCGATAGCTTGATTGAATGTGGCATCTGCTCTGACGCTGTTGCTTTTTGAACTGCGCCGAAAGAAAACTCATTCATCAGGCATCAGAGATCCCTGGGAATCGAAGGCCCTGAGGCGGTCAGTTTAGAGTTCCAATTCGTAACTTGGGATGAGCTCGCGCTAAGGCCGACGACTGTCATGTTTTCATTGTTTTCATTGCCGAGACCAACCAAA

Full Affymetrix probeset data:

Annotations for 1633605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720