Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633606_s_at:

>probe:Drosophila_2:1633606_s_at:650:407; Interrogation_Position=298; Antisense; GACGTTGTCCACACAGGCCACGACG
>probe:Drosophila_2:1633606_s_at:278:637; Interrogation_Position=350; Antisense; TCGTCGTCGCCCAACCGTGTGGTGA
>probe:Drosophila_2:1633606_s_at:28:599; Interrogation_Position=414; Antisense; TGTCCTCGTTCAGCCTTAAGCAACT
>probe:Drosophila_2:1633606_s_at:254:127; Interrogation_Position=425; Antisense; AGCCTTAAGCAACTGCTGGCCAAGA
>probe:Drosophila_2:1633606_s_at:230:523; Interrogation_Position=463; Antisense; GGGCCTGCGCAAGCTCTAGAATGGA
>probe:Drosophila_2:1633606_s_at:572:675; Interrogation_Position=505; Antisense; TAGAGCGATGCCAACGCCAACGGTT
>probe:Drosophila_2:1633606_s_at:715:293; Interrogation_Position=537; Antisense; CGATGAGGAGCCAGAGCGCCATGTC
>probe:Drosophila_2:1633606_s_at:67:505; Interrogation_Position=559; Antisense; GTCCTGAGGTCACACATTCGATATT
>probe:Drosophila_2:1633606_s_at:327:717; Interrogation_Position=575; Antisense; TTCGATATTTTCATCATCCGCCATC
>probe:Drosophila_2:1633606_s_at:357:315; Interrogation_Position=594; Antisense; GCCATCATCGTGTATATTTGCCTAA
>probe:Drosophila_2:1633606_s_at:415:695; Interrogation_Position=610; Antisense; TTTGCCTAAGTTAAGTCACCCACTC
>probe:Drosophila_2:1633606_s_at:78:263; Interrogation_Position=639; Antisense; CAGACCCAAGCGGAACTCGGACATG
>probe:Drosophila_2:1633606_s_at:136:145; Interrogation_Position=653; Antisense; ACTCGGACATGGAGGCTTGTTTTGT
>probe:Drosophila_2:1633606_s_at:507:343; Interrogation_Position=667; Antisense; GCTTGTTTTGTAATATTCTGTTCGA

Paste this into a BLAST search page for me
GACGTTGTCCACACAGGCCACGACGTCGTCGTCGCCCAACCGTGTGGTGATGTCCTCGTTCAGCCTTAAGCAACTAGCCTTAAGCAACTGCTGGCCAAGAGGGCCTGCGCAAGCTCTAGAATGGATAGAGCGATGCCAACGCCAACGGTTCGATGAGGAGCCAGAGCGCCATGTCGTCCTGAGGTCACACATTCGATATTTTCGATATTTTCATCATCCGCCATCGCCATCATCGTGTATATTTGCCTAATTTGCCTAAGTTAAGTCACCCACTCCAGACCCAAGCGGAACTCGGACATGACTCGGACATGGAGGCTTGTTTTGTGCTTGTTTTGTAATATTCTGTTCGA

Full Affymetrix probeset data:

Annotations for 1633606_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime