FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633607_at:

>probe:Drosophila_2:1633607_at:701:329; Interrogation_Position=171; Antisense; GCGGCCGTTGCCAAGGTCAAACTGA
>probe:Drosophila_2:1633607_at:167:195; Interrogation_Position=190; Antisense; AACTGAACAATTCATCGCATCCCGG
>probe:Drosophila_2:1633607_at:203:271; Interrogation_Position=207; Antisense; CATCCCGGCAAGTGTGTGCTGGACA
>probe:Drosophila_2:1633607_at:596:507; Interrogation_Position=222; Antisense; GTGCTGGACACGAACACGATCCTGT
>probe:Drosophila_2:1633607_at:217:39; Interrogation_Position=274; Antisense; ATCTGCCATGCGTGCGGGCCGAATG
>probe:Drosophila_2:1633607_at:575:51; Interrogation_Position=301; Antisense; ATGCGGATGGCTTGGTGACCTTCAA
>probe:Drosophila_2:1633607_at:49:513; Interrogation_Position=315; Antisense; GTGACCTTCAAAACCTGCGATGCAG
>probe:Drosophila_2:1633607_at:251:209; Interrogation_Position=360; Antisense; AAGCAGCGCGACTTTGTGAACATCA
>probe:Drosophila_2:1633607_at:644:189; Interrogation_Position=378; Antisense; AACATCAATCGCGAATTTCCCGCTT
>probe:Drosophila_2:1633607_at:512:721; Interrogation_Position=422; Antisense; TTGCGACAAGCACATCTAACATCTT
>probe:Drosophila_2:1633607_at:641:313; Interrogation_Position=462; Antisense; GCCATAATCCTTAAGTTGCTCAACT
>probe:Drosophila_2:1633607_at:133:427; Interrogation_Position=49; Antisense; GAGTTTCCACCAGAGATTACCCAAA
>probe:Drosophila_2:1633607_at:448:393; Interrogation_Position=76; Antisense; GAAATCCAGTATCGAGCAGTATGTC
>probe:Drosophila_2:1633607_at:498:89; Interrogation_Position=93; Antisense; AGTATGTCGCAGTTTAGCACCGTTG

Paste this into a BLAST search page for me
GCGGCCGTTGCCAAGGTCAAACTGAAACTGAACAATTCATCGCATCCCGGCATCCCGGCAAGTGTGTGCTGGACAGTGCTGGACACGAACACGATCCTGTATCTGCCATGCGTGCGGGCCGAATGATGCGGATGGCTTGGTGACCTTCAAGTGACCTTCAAAACCTGCGATGCAGAAGCAGCGCGACTTTGTGAACATCAAACATCAATCGCGAATTTCCCGCTTTTGCGACAAGCACATCTAACATCTTGCCATAATCCTTAAGTTGCTCAACTGAGTTTCCACCAGAGATTACCCAAAGAAATCCAGTATCGAGCAGTATGTCAGTATGTCGCAGTTTAGCACCGTTG

Full Affymetrix probeset data:

Annotations for 1633607_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720