Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633609_at:

>probe:Drosophila_2:1633609_at:423:437; Interrogation_Position=188; Antisense; GAGGACATGTCCATTTACGTGAAAA
>probe:Drosophila_2:1633609_at:218:425; Interrogation_Position=233; Antisense; GAGAGCTACGCTAATCCGAACAGGA
>probe:Drosophila_2:1633609_at:564:99; Interrogation_Position=252; Antisense; ACAGGATCGTAGTTAAGCCGCCCTA
>probe:Drosophila_2:1633609_at:246:205; Interrogation_Position=266; Antisense; AAGCCGCCCTACGAGATTACCGAGA
>probe:Drosophila_2:1633609_at:709:197; Interrogation_Position=332; Antisense; AACGATCAATCAGAGCGCCCGGTTA
>probe:Drosophila_2:1633609_at:558:539; Interrogation_Position=352; Antisense; GGTTACCTGCTACCACATCCTTAAG
>probe:Drosophila_2:1633609_at:17:711; Interrogation_Position=372; Antisense; TTAAGCTCTTCCAATCGCCTGTGGT
>probe:Drosophila_2:1633609_at:538:591; Interrogation_Position=393; Antisense; TGGTCGATGGCGAGCTCTCCTCTAG
>probe:Drosophila_2:1633609_at:214:277; Interrogation_Position=432; Antisense; CTAAGAAGGGCCTGGTCTCGGAGTC
>probe:Drosophila_2:1633609_at:698:395; Interrogation_Position=464; Antisense; GAAATAGTGTTCCAGGAGCCCACCC
>probe:Drosophila_2:1633609_at:174:345; Interrogation_Position=499; Antisense; GCATTATCTCCTGCTTTCAGAACAG
>probe:Drosophila_2:1633609_at:519:153; Interrogation_Position=520; Antisense; ACAGAGCGCCAATGGGTTGCTAACC
>probe:Drosophila_2:1633609_at:97:725; Interrogation_Position=536; Antisense; TTGCTAACCCATGACACTGACTTTG
>probe:Drosophila_2:1633609_at:66:567; Interrogation_Position=652; Antisense; GGCACGTGAGACCATTTCGAAGTTC

Paste this into a BLAST search page for me
GAGGACATGTCCATTTACGTGAAAAGAGAGCTACGCTAATCCGAACAGGAACAGGATCGTAGTTAAGCCGCCCTAAAGCCGCCCTACGAGATTACCGAGAAACGATCAATCAGAGCGCCCGGTTAGGTTACCTGCTACCACATCCTTAAGTTAAGCTCTTCCAATCGCCTGTGGTTGGTCGATGGCGAGCTCTCCTCTAGCTAAGAAGGGCCTGGTCTCGGAGTCGAAATAGTGTTCCAGGAGCCCACCCGCATTATCTCCTGCTTTCAGAACAGACAGAGCGCCAATGGGTTGCTAACCTTGCTAACCCATGACACTGACTTTGGGCACGTGAGACCATTTCGAAGTTC

Full Affymetrix probeset data:

Annotations for 1633609_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime