Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633613_at:

>probe:Drosophila_2:1633613_at:207:109; Interrogation_Position=1744; Antisense; AGAAGCGAGTCGCATCTATCCCAAT
>probe:Drosophila_2:1633613_at:544:237; Interrogation_Position=1766; Antisense; AATCATTCCTTCTGTACCCGTTGGG
>probe:Drosophila_2:1633613_at:358:163; Interrogation_Position=1813; Antisense; AAATAACCACCATGGCGCAGCGGTG
>probe:Drosophila_2:1633613_at:611:295; Interrogation_Position=1847; Antisense; CGAATATCCCTCTTCTTTACAATTG
>probe:Drosophila_2:1633613_at:504:117; Interrogation_Position=2001; Antisense; AGCTATGCTTGTGGAGACGGGACCA
>probe:Drosophila_2:1633613_at:423:413; Interrogation_Position=2021; Antisense; GACCACTTCACTTTTAGCCTGTATG
>probe:Drosophila_2:1633613_at:643:477; Interrogation_Position=2080; Antisense; GTTTAAGCCAACTATTTGTGCCGTT
>probe:Drosophila_2:1633613_at:490:19; Interrogation_Position=2093; Antisense; ATTTGTGCCGTTATGTTTCGTTTGA
>probe:Drosophila_2:1633613_at:97:695; Interrogation_Position=2108; Antisense; TTTCGTTTGATTTCCACTTCGCAGC
>probe:Drosophila_2:1633613_at:559:81; Interrogation_Position=2138; Antisense; AGGGACACCCAGTGGTTACAGCAGG
>probe:Drosophila_2:1633613_at:383:447; Interrogation_Position=2166; Antisense; GATCTCCTAAATCCCACCAAAGGTG
>probe:Drosophila_2:1633613_at:140:171; Interrogation_Position=2184; Antisense; AAAGGTGACCTGGATACCCGACTGT
>probe:Drosophila_2:1633613_at:658:593; Interrogation_Position=2206; Antisense; TGTGAGTCCCTGGTTCGGCAACGAG
>probe:Drosophila_2:1633613_at:611:277; Interrogation_Position=2255; Antisense; CTAACGTTAATAGCGCTTGTGCGAG

Paste this into a BLAST search page for me
AGAAGCGAGTCGCATCTATCCCAATAATCATTCCTTCTGTACCCGTTGGGAAATAACCACCATGGCGCAGCGGTGCGAATATCCCTCTTCTTTACAATTGAGCTATGCTTGTGGAGACGGGACCAGACCACTTCACTTTTAGCCTGTATGGTTTAAGCCAACTATTTGTGCCGTTATTTGTGCCGTTATGTTTCGTTTGATTTCGTTTGATTTCCACTTCGCAGCAGGGACACCCAGTGGTTACAGCAGGGATCTCCTAAATCCCACCAAAGGTGAAAGGTGACCTGGATACCCGACTGTTGTGAGTCCCTGGTTCGGCAACGAGCTAACGTTAATAGCGCTTGTGCGAG

Full Affymetrix probeset data:

Annotations for 1633613_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime