FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633615_at:

>probe:Drosophila_2:1633615_at:18:325; Interrogation_Position=107; Antisense; GCGCATCAGCGGCAACTTAACGAGT
>probe:Drosophila_2:1633615_at:641:3; Interrogation_Position=140; Antisense; ATTGGTAGACGCCTCAAGCGGCTGA
>probe:Drosophila_2:1633615_at:558:611; Interrogation_Position=162; Antisense; TGACGGGCAAGAGGTCCAGCGACTT
>probe:Drosophila_2:1633615_at:114:295; Interrogation_Position=267; Antisense; CGATGCCGTTGCCAATGGCCAGGAA
>probe:Drosophila_2:1633615_at:211:351; Interrogation_Position=301; Antisense; GCAGATCAGACGCAATCATCCGAAT
>probe:Drosophila_2:1633615_at:2:31; Interrogation_Position=354; Antisense; ATAACACCTTGGATCTACTTGTCGT
>probe:Drosophila_2:1633615_at:105:151; Interrogation_Position=370; Antisense; ACTTGTCGTGGGTCAACAGCTGCAA
>probe:Drosophila_2:1633615_at:160:321; Interrogation_Position=451; Antisense; GCCCCGCCAGCATATCGAAGAGTAT
>probe:Drosophila_2:1633615_at:400:427; Interrogation_Position=470; Antisense; GAGTATGTCTATTTCTATCCGGTCC
>probe:Drosophila_2:1633615_at:616:683; Interrogation_Position=485; Antisense; TATCCGGTCCACTACCATGAGACGG
>probe:Drosophila_2:1633615_at:127:579; Interrogation_Position=527; Antisense; GGCCAGCCGGAACCAAATCTTGTGG
>probe:Drosophila_2:1633615_at:126:459; Interrogation_Position=561; Antisense; GATTTGTGGCCGAGCTACTGGATGA
>probe:Drosophila_2:1633615_at:393:283; Interrogation_Position=593; Antisense; CTGCCTGCAGGCAATCGTATTTGAT
>probe:Drosophila_2:1633615_at:659:137; Interrogation_Position=75; Antisense; ACGTTGCAACAACACTTTGGCGCTT

Paste this into a BLAST search page for me
GCGCATCAGCGGCAACTTAACGAGTATTGGTAGACGCCTCAAGCGGCTGATGACGGGCAAGAGGTCCAGCGACTTCGATGCCGTTGCCAATGGCCAGGAAGCAGATCAGACGCAATCATCCGAATATAACACCTTGGATCTACTTGTCGTACTTGTCGTGGGTCAACAGCTGCAAGCCCCGCCAGCATATCGAAGAGTATGAGTATGTCTATTTCTATCCGGTCCTATCCGGTCCACTACCATGAGACGGGGCCAGCCGGAACCAAATCTTGTGGGATTTGTGGCCGAGCTACTGGATGACTGCCTGCAGGCAATCGTATTTGATACGTTGCAACAACACTTTGGCGCTT

Full Affymetrix probeset data:

Annotations for 1633615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720