FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633616_at:

>probe:Drosophila_2:1633616_at:626:523; Interrogation_Position=373; Antisense; GGGATGAAACCGAACGTCAACGTCT
>probe:Drosophila_2:1633616_at:98:175; Interrogation_Position=379; Antisense; AAACCGAACGTCAACGTCTGGCGCT
>probe:Drosophila_2:1633616_at:230:383; Interrogation_Position=384; Antisense; GAACGTCAACGTCTGGCGCTGGCCA
>probe:Drosophila_2:1633616_at:353:211; Interrogation_Position=408; Antisense; AAGAAGCTCACCATTACGGCGACAA
>probe:Drosophila_2:1633616_at:575:207; Interrogation_Position=411; Antisense; AAGCTCACCATTACGGCGACAACGT
>probe:Drosophila_2:1633616_at:590:271; Interrogation_Position=419; Antisense; CATTACGGCGACAACGTCGGCGGAG
>probe:Drosophila_2:1633616_at:193:347; Interrogation_Position=461; Antisense; GCAGGAGGAACTGGACGCCGAGCTG
>probe:Drosophila_2:1633616_at:483:287; Interrogation_Position=483; Antisense; CTGGACGAACTGATGAGCGAGGACT
>probe:Drosophila_2:1633616_at:407:565; Interrogation_Position=559; Antisense; GGCACCACCAGCAGTTTGGCCAGGT
>probe:Drosophila_2:1633616_at:62:263; Interrogation_Position=564; Antisense; CACCAGCAGTTTGGCCAGGTGCAGC
>probe:Drosophila_2:1633616_at:91:81; Interrogation_Position=580; Antisense; AGGTGCAGCAGTTGACCAGCCACGA
>probe:Drosophila_2:1633616_at:73:115; Interrogation_Position=586; Antisense; AGCAGTTGACCAGCCACGAGGAGTT
>probe:Drosophila_2:1633616_at:107:139; Interrogation_Position=601; Antisense; ACGAGGAGTTCCTCGCCTGCGTCGA
>probe:Drosophila_2:1633616_at:687:93; Interrogation_Position=607; Antisense; AGTTCCTCGCCTGCGTCGAGCAGGA

Paste this into a BLAST search page for me
GGGATGAAACCGAACGTCAACGTCTAAACCGAACGTCAACGTCTGGCGCTGAACGTCAACGTCTGGCGCTGGCCAAAGAAGCTCACCATTACGGCGACAAAAGCTCACCATTACGGCGACAACGTCATTACGGCGACAACGTCGGCGGAGGCAGGAGGAACTGGACGCCGAGCTGCTGGACGAACTGATGAGCGAGGACTGGCACCACCAGCAGTTTGGCCAGGTCACCAGCAGTTTGGCCAGGTGCAGCAGGTGCAGCAGTTGACCAGCCACGAAGCAGTTGACCAGCCACGAGGAGTTACGAGGAGTTCCTCGCCTGCGTCGAAGTTCCTCGCCTGCGTCGAGCAGGA

Full Affymetrix probeset data:

Annotations for 1633616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720