Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633617_at:

>probe:Drosophila_2:1633617_at:509:723; Interrogation_Position=100; Antisense; TTGCTTATCGTCAACATTGCCTCCA
>probe:Drosophila_2:1633617_at:658:7; Interrogation_Position=115; Antisense; ATTGCCTCCAAATGCGGACTTACTT
>probe:Drosophila_2:1633617_at:489:701; Interrogation_Position=139; Antisense; TTATCTCAGTACAACGGTTTGCGCT
>probe:Drosophila_2:1633617_at:663:539; Interrogation_Position=154; Antisense; GGTTTGCGCTATTTACTCGAGGAAT
>probe:Drosophila_2:1633617_at:184:441; Interrogation_Position=17; Antisense; GATGGCGTCTGACGATACACGCTCT
>probe:Drosophila_2:1633617_at:239:167; Interrogation_Position=233; Antisense; AAATGCCCGAGTCCGATGGCCAGGA
>probe:Drosophila_2:1633617_at:297:25; Interrogation_Position=292; Antisense; ATAGGACACCTCTTTGCCAAGATAG
>probe:Drosophila_2:1633617_at:418:419; Interrogation_Position=326; Antisense; GAGCTCAGGCAGATCCGCTGTACAA
>probe:Drosophila_2:1633617_at:702:133; Interrogation_Position=358; Antisense; ACGCGCCACCAGCATGATATCGAAT
>probe:Drosophila_2:1633617_at:292:337; Interrogation_Position=37; Antisense; GCTCTCACCGTTCGAGATACGTTTG
>probe:Drosophila_2:1633617_at:592:21; Interrogation_Position=432; Antisense; ATATGGCGCCGAACTGGAACCAGTT
>probe:Drosophila_2:1633617_at:414:469; Interrogation_Position=454; Antisense; GTTGCCCTGACCGATGACATAGAGC
>probe:Drosophila_2:1633617_at:341:527; Interrogation_Position=61; Antisense; GGGAATCCAGTGCAACTCGATACAT
>probe:Drosophila_2:1633617_at:536:9; Interrogation_Position=84; Antisense; ATTCGCCGGCCATGTGTTGCTTATC

Paste this into a BLAST search page for me
TTGCTTATCGTCAACATTGCCTCCAATTGCCTCCAAATGCGGACTTACTTTTATCTCAGTACAACGGTTTGCGCTGGTTTGCGCTATTTACTCGAGGAATGATGGCGTCTGACGATACACGCTCTAAATGCCCGAGTCCGATGGCCAGGAATAGGACACCTCTTTGCCAAGATAGGAGCTCAGGCAGATCCGCTGTACAAACGCGCCACCAGCATGATATCGAATGCTCTCACCGTTCGAGATACGTTTGATATGGCGCCGAACTGGAACCAGTTGTTGCCCTGACCGATGACATAGAGCGGGAATCCAGTGCAACTCGATACATATTCGCCGGCCATGTGTTGCTTATC

Full Affymetrix probeset data:

Annotations for 1633617_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime