FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633618_at:

>probe:Drosophila_2:1633618_at:642:205; Interrogation_Position=344; Antisense; AAGCGATGCCTGCAAATTCTGCGAG
>probe:Drosophila_2:1633618_at:548:9; Interrogation_Position=359; Antisense; ATTCTGCGAGAGCACGGACTGCGAT
>probe:Drosophila_2:1633618_at:238:149; Interrogation_Position=390; Antisense; ACTTTTGTCGTCAGTTCACCGTGAA
>probe:Drosophila_2:1633618_at:170:173; Interrogation_Position=464; Antisense; AAAGAACTGCTCCTCTGGGCTGCGG
>probe:Drosophila_2:1633618_at:122:523; Interrogation_Position=495; Antisense; GGGCTGGCAAACACTGTCAGGTACT
>probe:Drosophila_2:1633618_at:581:489; Interrogation_Position=515; Antisense; GTACTTCTTCTGAGTTCGTTTGGCA
>probe:Drosophila_2:1633618_at:135:359; Interrogation_Position=537; Antisense; GCAAGAATGGACTGCCGGCCTTTAT
>probe:Drosophila_2:1633618_at:611:339; Interrogation_Position=586; Antisense; GCTAAAGAACTTTCGATCCGCCTAT
>probe:Drosophila_2:1633618_at:604:209; Interrogation_Position=632; Antisense; AAGCAGCTCATCCTTAGCCAAAAAG
>probe:Drosophila_2:1633618_at:225:489; Interrogation_Position=670; Antisense; GTACGAGCTACCCAGCACTGATGAT
>probe:Drosophila_2:1633618_at:349:57; Interrogation_Position=696; Antisense; ATGAGCTCTACTACTCTGGCAAGGA
>probe:Drosophila_2:1633618_at:347:659; Interrogation_Position=807; Antisense; TAAGATCCTCCGGTGGACTGATGTC
>probe:Drosophila_2:1633618_at:723:445; Interrogation_Position=865; Antisense; GATGCCATCCTGCAGCCAAGGAGTG
>probe:Drosophila_2:1633618_at:328:395; Interrogation_Position=915; Antisense; GACAGAAATTTCTGGCTGCCCTTTA

Paste this into a BLAST search page for me
AAGCGATGCCTGCAAATTCTGCGAGATTCTGCGAGAGCACGGACTGCGATACTTTTGTCGTCAGTTCACCGTGAAAAAGAACTGCTCCTCTGGGCTGCGGGGGCTGGCAAACACTGTCAGGTACTGTACTTCTTCTGAGTTCGTTTGGCAGCAAGAATGGACTGCCGGCCTTTATGCTAAAGAACTTTCGATCCGCCTATAAGCAGCTCATCCTTAGCCAAAAAGGTACGAGCTACCCAGCACTGATGATATGAGCTCTACTACTCTGGCAAGGATAAGATCCTCCGGTGGACTGATGTCGATGCCATCCTGCAGCCAAGGAGTGGACAGAAATTTCTGGCTGCCCTTTA

Full Affymetrix probeset data:

Annotations for 1633618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720