FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633621_at:

>probe:Drosophila_2:1633621_at:404:517; Interrogation_Position=1023; Antisense; GTGTGTCCTTTGAGTGGGCTGCAAA
>probe:Drosophila_2:1633621_at:504:285; Interrogation_Position=573; Antisense; CTGAGGCTCCTGGAACCACTGAAAA
>probe:Drosophila_2:1633621_at:167:389; Interrogation_Position=626; Antisense; GAAAAACCAGCCACGGATGCACCTG
>probe:Drosophila_2:1633621_at:540:547; Interrogation_Position=640; Antisense; GGATGCACCTGGAACCACTGAGAAA
>probe:Drosophila_2:1633621_at:501:647; Interrogation_Position=665; Antisense; TCAGAAACTACTGATGCTCCCGGCA
>probe:Drosophila_2:1633621_at:19:35; Interrogation_Position=700; Antisense; ATCAGATACTGATGCTCCCATTACC
>probe:Drosophila_2:1633621_at:227:285; Interrogation_Position=741; Antisense; CTGAGACCAGTACCGATGAGCCCAA
>probe:Drosophila_2:1633621_at:118:43; Interrogation_Position=800; Antisense; ATCGAGGACAATGTGTGCGCCACCA
>probe:Drosophila_2:1633621_at:294:713; Interrogation_Position=857; Antisense; TTCATCGTCTGCAGCTACGCCGAAG
>probe:Drosophila_2:1633621_at:223:419; Interrogation_Position=887; Antisense; GAGCTGAAGGCCTACACGAAGAAGT
>probe:Drosophila_2:1633621_at:723:515; Interrogation_Position=910; Antisense; GTGTCCTGGCGAGATGCAGTTCGAT
>probe:Drosophila_2:1633621_at:15:93; Interrogation_Position=927; Antisense; AGTTCGATCCCTTCAACAGCGTTTG
>probe:Drosophila_2:1633621_at:403:185; Interrogation_Position=941; Antisense; AACAGCGTTTGCTCAGCGTCTTACG
>probe:Drosophila_2:1633621_at:22:123; Interrogation_Position=955; Antisense; AGCGTCTTACGACTGCACTGCAGGA

Paste this into a BLAST search page for me
GTGTGTCCTTTGAGTGGGCTGCAAACTGAGGCTCCTGGAACCACTGAAAAGAAAAACCAGCCACGGATGCACCTGGGATGCACCTGGAACCACTGAGAAATCAGAAACTACTGATGCTCCCGGCAATCAGATACTGATGCTCCCATTACCCTGAGACCAGTACCGATGAGCCCAAATCGAGGACAATGTGTGCGCCACCATTCATCGTCTGCAGCTACGCCGAAGGAGCTGAAGGCCTACACGAAGAAGTGTGTCCTGGCGAGATGCAGTTCGATAGTTCGATCCCTTCAACAGCGTTTGAACAGCGTTTGCTCAGCGTCTTACGAGCGTCTTACGACTGCACTGCAGGA

Full Affymetrix probeset data:

Annotations for 1633621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720