Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633622_at:

>probe:Drosophila_2:1633622_at:488:433; Interrogation_Position=1685; Antisense; GAGTGTCGAACCGAAGCATCCCAGT
>probe:Drosophila_2:1633622_at:441:631; Interrogation_Position=1720; Antisense; TCCTGATGAGGGATTGCGGCAACAT
>probe:Drosophila_2:1633622_at:150:709; Interrogation_Position=1747; Antisense; TTAACTTCTTTGAACGACGCGGCCT
>probe:Drosophila_2:1633622_at:368:317; Interrogation_Position=1768; Antisense; GCCTGCCCAACATTTACACCAAGGA
>probe:Drosophila_2:1633622_at:648:471; Interrogation_Position=1799; Antisense; GTTCGAGTTTATTACGGGTCTCAAT
>probe:Drosophila_2:1633622_at:85:531; Interrogation_Position=1814; Antisense; GGGTCTCAATTCAGAGGTCCACACC
>probe:Drosophila_2:1633622_at:2:121; Interrogation_Position=1846; Antisense; AGCTGGAGCAGATCCACACGCGTGG
>probe:Drosophila_2:1633622_at:405:133; Interrogation_Position=1863; Antisense; ACGCGTGGCGCTTCCATTAGCCAAG
>probe:Drosophila_2:1633622_at:149:253; Interrogation_Position=1884; Antisense; CAAGCCACTGCTCCGAATCAGGAGG
>probe:Drosophila_2:1633622_at:302:391; Interrogation_Position=1925; Antisense; GAAACCCTTGGAGTATCCCTTTGAG
>probe:Drosophila_2:1633622_at:515:681; Interrogation_Position=1938; Antisense; TATCCCTTTGAGCTGGCCTGGGAAA
>probe:Drosophila_2:1633622_at:562:215; Interrogation_Position=1972; Antisense; AAGATCGCGCTGCTCAAAAGGCTCT
>probe:Drosophila_2:1633622_at:341:169; Interrogation_Position=1988; Antisense; AAAGGCTCTGCAGCAAGCGCAGGAT
>probe:Drosophila_2:1633622_at:403:193; Interrogation_Position=2099; Antisense; AACTGCCAACCATTGAAACTTCTAA

Paste this into a BLAST search page for me
GAGTGTCGAACCGAAGCATCCCAGTTCCTGATGAGGGATTGCGGCAACATTTAACTTCTTTGAACGACGCGGCCTGCCTGCCCAACATTTACACCAAGGAGTTCGAGTTTATTACGGGTCTCAATGGGTCTCAATTCAGAGGTCCACACCAGCTGGAGCAGATCCACACGCGTGGACGCGTGGCGCTTCCATTAGCCAAGCAAGCCACTGCTCCGAATCAGGAGGGAAACCCTTGGAGTATCCCTTTGAGTATCCCTTTGAGCTGGCCTGGGAAAAAGATCGCGCTGCTCAAAAGGCTCTAAAGGCTCTGCAGCAAGCGCAGGATAACTGCCAACCATTGAAACTTCTAA

Full Affymetrix probeset data:

Annotations for 1633622_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime