Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633623_s_at:

>probe:Drosophila_2:1633623_s_at:598:79; Interrogation_Position=101; Antisense; AGGGCCCGAACCAGGATCTATATCC
>probe:Drosophila_2:1633623_s_at:51:79; Interrogation_Position=113; Antisense; AGGATCTATATCCTGACCAGACAGG
>probe:Drosophila_2:1633623_s_at:98:611; Interrogation_Position=126; Antisense; TGACCAGACAGGAGTAGCCTCCGCC
>probe:Drosophila_2:1633623_s_at:241:265; Interrogation_Position=134; Antisense; CAGGAGTAGCCTCCGCCCACGAGGA
>probe:Drosophila_2:1633623_s_at:357:239; Interrogation_Position=162; Antisense; AATCAAGCACGCCTGCTGCAGTCGC
>probe:Drosophila_2:1633623_s_at:148:267; Interrogation_Position=180; Antisense; CAGTCGCGGCGCTCAGCTGCTGAGA
>probe:Drosophila_2:1633623_s_at:286:119; Interrogation_Position=194; Antisense; AGCTGCTGAGATTGCGCCACCGAGA
>probe:Drosophila_2:1633623_s_at:724:579; Interrogation_Position=221; Antisense; TGGCCAAGCGACGAGCTCTCGAGGA
>probe:Drosophila_2:1633623_s_at:445:337; Interrogation_Position=235; Antisense; GCTCTCGAGGATCAGATTAACGCCA
>probe:Drosophila_2:1633623_s_at:351:13; Interrogation_Position=250; Antisense; ATTAACGCCAATCAAGAGGAGCAGG
>probe:Drosophila_2:1633623_s_at:322:73; Interrogation_Position=287; Antisense; AGGACTCTCGGGATCAGCAGGAGCC
>probe:Drosophila_2:1633623_s_at:644:193; Interrogation_Position=359; Antisense; AACTGCATCCGCAGCCAGTCCAATG
>probe:Drosophila_2:1633623_s_at:36:107; Interrogation_Position=74; Antisense; AGACATCCACGCGACTGCTGACGTA
>probe:Drosophila_2:1633623_s_at:110:401; Interrogation_Position=86; Antisense; GACTGCTGACGTACCAGGGCCCGAA

Paste this into a BLAST search page for me
AGGGCCCGAACCAGGATCTATATCCAGGATCTATATCCTGACCAGACAGGTGACCAGACAGGAGTAGCCTCCGCCCAGGAGTAGCCTCCGCCCACGAGGAAATCAAGCACGCCTGCTGCAGTCGCCAGTCGCGGCGCTCAGCTGCTGAGAAGCTGCTGAGATTGCGCCACCGAGATGGCCAAGCGACGAGCTCTCGAGGAGCTCTCGAGGATCAGATTAACGCCAATTAACGCCAATCAAGAGGAGCAGGAGGACTCTCGGGATCAGCAGGAGCCAACTGCATCCGCAGCCAGTCCAATGAGACATCCACGCGACTGCTGACGTAGACTGCTGACGTACCAGGGCCCGAA

Full Affymetrix probeset data:

Annotations for 1633623_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime