FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633626_at:

>probe:Drosophila_2:1633626_at:344:389; Interrogation_Position=126; Antisense; GAAAAAGTCGCGCAAAACGGCCAAT
>probe:Drosophila_2:1633626_at:699:315; Interrogation_Position=15; Antisense; GCCGGACTGTCAAAATGCAATGCAC
>probe:Drosophila_2:1633626_at:202:375; Interrogation_Position=183; Antisense; GAAGATCATTGAACTGCTGCACGAG
>probe:Drosophila_2:1633626_at:718:143; Interrogation_Position=195; Antisense; ACTGCTGCACGAGTACAACGACCTA
>probe:Drosophila_2:1633626_at:303:491; Interrogation_Position=207; Antisense; GTACAACGACCTAAAGGATGCCACC
>probe:Drosophila_2:1633626_at:441:123; Interrogation_Position=233; Antisense; AGCGCGTCCTGGAAGCCTTGGCCAA
>probe:Drosophila_2:1633626_at:533:377; Interrogation_Position=244; Antisense; GAAGCCTTGGCCAACCTAAAATGCG
>probe:Drosophila_2:1633626_at:717:277; Interrogation_Position=259; Antisense; CTAAAATGCGTACCCGTCGGATCGG
>probe:Drosophila_2:1633626_at:545:499; Interrogation_Position=274; Antisense; GTCGGATCGGTTTACGCTACATACA
>probe:Drosophila_2:1633626_at:123:233; Interrogation_Position=28; Antisense; AATGCAATGCACACAGCTGACGCGC
>probe:Drosophila_2:1633626_at:150:539; Interrogation_Position=282; Antisense; GGTTTACGCTACATACAACCTGCCC
>probe:Drosophila_2:1633626_at:203:119; Interrogation_Position=42; Antisense; AGCTGACGCGCTATCGATAGCGATA
>probe:Drosophila_2:1633626_at:335:457; Interrogation_Position=57; Antisense; GATAGCGATATCAACCGATAGCAGT
>probe:Drosophila_2:1633626_at:720:455; Interrogation_Position=73; Antisense; GATAGCAGTAATTCCAATCCAATTG

Paste this into a BLAST search page for me
GAAAAAGTCGCGCAAAACGGCCAATGCCGGACTGTCAAAATGCAATGCACGAAGATCATTGAACTGCTGCACGAGACTGCTGCACGAGTACAACGACCTAGTACAACGACCTAAAGGATGCCACCAGCGCGTCCTGGAAGCCTTGGCCAAGAAGCCTTGGCCAACCTAAAATGCGCTAAAATGCGTACCCGTCGGATCGGGTCGGATCGGTTTACGCTACATACAAATGCAATGCACACAGCTGACGCGCGGTTTACGCTACATACAACCTGCCCAGCTGACGCGCTATCGATAGCGATAGATAGCGATATCAACCGATAGCAGTGATAGCAGTAATTCCAATCCAATTG

Full Affymetrix probeset data:

Annotations for 1633626_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720