FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633627_at:

>probe:Drosophila_2:1633627_at:468:291; Interrogation_Position=1003; Antisense; CGTCTGCTGGATCACTTGGACATGA
>probe:Drosophila_2:1633627_at:361:7; Interrogation_Position=1065; Antisense; ATTGAAGCAACAATCCGCCAGGATT
>probe:Drosophila_2:1633627_at:447:453; Interrogation_Position=1107; Antisense; GATCAAAACCATTCAGGCCGAGCCG
>probe:Drosophila_2:1633627_at:457:573; Interrogation_Position=1149; Antisense; GGCGGAGCCACAGACCAAGATTCTT
>probe:Drosophila_2:1633627_at:384:439; Interrogation_Position=1180; Antisense; GAGGCGATCCAGACTGAGCAGCCGA
>probe:Drosophila_2:1633627_at:385:329; Interrogation_Position=651; Antisense; GCAGGAACCCGAACCGACGTTGGCA
>probe:Drosophila_2:1633627_at:314:467; Interrogation_Position=669; Antisense; GTTGGCATCGGCTGAAACTGCTTTA
>probe:Drosophila_2:1633627_at:219:371; Interrogation_Position=705; Antisense; GAAGGCTGAACCACTTGCTGAGATC
>probe:Drosophila_2:1633627_at:348:553; Interrogation_Position=735; Antisense; GGAGCCACTGGCTGAGATCAAGTCA
>probe:Drosophila_2:1633627_at:319:97; Interrogation_Position=749; Antisense; AGATCAAGTCAGAGCCGCTGGCTGA
>probe:Drosophila_2:1633627_at:281:317; Interrogation_Position=780; Antisense; GCCGGAACCACAGGCCTTGTTTAAG
>probe:Drosophila_2:1633627_at:323:701; Interrogation_Position=796; Antisense; TTGTTTAAGGAACAGCCCCTGCTGA
>probe:Drosophila_2:1633627_at:337:291; Interrogation_Position=831; Antisense; CGTGCTAAAGGAACAGCCCCTGTTG
>probe:Drosophila_2:1633627_at:705:613; Interrogation_Position=962; Antisense; TGAAGCCCACTATTCCTGATTCTAA

Paste this into a BLAST search page for me
CGTCTGCTGGATCACTTGGACATGAATTGAAGCAACAATCCGCCAGGATTGATCAAAACCATTCAGGCCGAGCCGGGCGGAGCCACAGACCAAGATTCTTGAGGCGATCCAGACTGAGCAGCCGAGCAGGAACCCGAACCGACGTTGGCAGTTGGCATCGGCTGAAACTGCTTTAGAAGGCTGAACCACTTGCTGAGATCGGAGCCACTGGCTGAGATCAAGTCAAGATCAAGTCAGAGCCGCTGGCTGAGCCGGAACCACAGGCCTTGTTTAAGTTGTTTAAGGAACAGCCCCTGCTGACGTGCTAAAGGAACAGCCCCTGTTGTGAAGCCCACTATTCCTGATTCTAA

Full Affymetrix probeset data:

Annotations for 1633627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720