Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633630_at:

>probe:Drosophila_2:1633630_at:629:667; Interrogation_Position=1175; Antisense; TACTACGGCCTGGTGCTGGTCACGA
>probe:Drosophila_2:1633630_at:511:425; Interrogation_Position=1226; Antisense; GAGAGCCATCCCAATGAGTGCGTCA
>probe:Drosophila_2:1633630_at:394:403; Interrogation_Position=1265; Antisense; GACTTTATGGACCTGCTGTGGATCA
>probe:Drosophila_2:1633630_at:588:429; Interrogation_Position=1298; Antisense; GAGTTTCCTGGAATACTGCTGACCA
>probe:Drosophila_2:1633630_at:640:387; Interrogation_Position=1351; Antisense; GAAAACCATTGTTCTGCAGTACCTG
>probe:Drosophila_2:1633630_at:187:91; Interrogation_Position=1368; Antisense; AGTACCTGGCGCTGGTTCTGTGCAC
>probe:Drosophila_2:1633630_at:600:145; Interrogation_Position=1391; Antisense; ACTCTGGTGCTGATGTCGGTGGAAA
>probe:Drosophila_2:1633630_at:208:577; Interrogation_Position=1477; Antisense; GGCCATTTATGTGTACACTCCGGAA
>probe:Drosophila_2:1633630_at:484:559; Interrogation_Position=1498; Antisense; GGAAATATACCCAGCTGCCTTGAGA
>probe:Drosophila_2:1633630_at:78:119; Interrogation_Position=1510; Antisense; AGCTGCCTTGAGATCCGTCGGAGTT
>probe:Drosophila_2:1633630_at:665:323; Interrogation_Position=1586; Antisense; GCGCAGGTGCTGATGGACTCGTCCA
>probe:Drosophila_2:1633630_at:634:107; Interrogation_Position=1610; Antisense; AGAATTCAGGCCATGTCCACGTACG
>probe:Drosophila_2:1633630_at:583:495; Interrogation_Position=1667; Antisense; GTCTTTCTGCCCAGGGAAACTGTTG
>probe:Drosophila_2:1633630_at:638:195; Interrogation_Position=1684; Antisense; AACTGTTGGCTACCACTGAGTGCAC

Paste this into a BLAST search page for me
TACTACGGCCTGGTGCTGGTCACGAGAGAGCCATCCCAATGAGTGCGTCAGACTTTATGGACCTGCTGTGGATCAGAGTTTCCTGGAATACTGCTGACCAGAAAACCATTGTTCTGCAGTACCTGAGTACCTGGCGCTGGTTCTGTGCACACTCTGGTGCTGATGTCGGTGGAAAGGCCATTTATGTGTACACTCCGGAAGGAAATATACCCAGCTGCCTTGAGAAGCTGCCTTGAGATCCGTCGGAGTTGCGCAGGTGCTGATGGACTCGTCCAAGAATTCAGGCCATGTCCACGTACGGTCTTTCTGCCCAGGGAAACTGTTGAACTGTTGGCTACCACTGAGTGCAC

Full Affymetrix probeset data:

Annotations for 1633630_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime