Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633631_at:

>probe:Drosophila_2:1633631_at:226:721; Interrogation_Position=1102; Antisense; TTGCGCATGATGCTGCAAATGCTGC
>probe:Drosophila_2:1633631_at:221:395; Interrogation_Position=1237; Antisense; GAAATGCGGCCGGAGATGTTGCAAA
>probe:Drosophila_2:1633631_at:560:233; Interrogation_Position=1260; Antisense; AATGCCGCCGGAAATGTTGCTGGAA
>probe:Drosophila_2:1633631_at:320:395; Interrogation_Position=1282; Antisense; GAAATGCATCAAATGCTGCTGGAGA
>probe:Drosophila_2:1633631_at:220:395; Interrogation_Position=1324; Antisense; GAAATGTTGCTGGAAGTGTTGCTAA
>probe:Drosophila_2:1633631_at:317:373; Interrogation_Position=1336; Antisense; GAAGTGTTGCTAATGCTGCTGGAAA
>probe:Drosophila_2:1633631_at:677:283; Interrogation_Position=1384; Antisense; CTGCTGGTGATGTTGCAAATGCCGC
>probe:Drosophila_2:1633631_at:27:119; Interrogation_Position=1529; Antisense; AGCTAATGCTGCTGGAAATGTTGCA
>probe:Drosophila_2:1633631_at:191:361; Interrogation_Position=1560; Antisense; GCAAGCAACATTTTCCATTCCATAT
>probe:Drosophila_2:1633631_at:113:275; Interrogation_Position=1575; Antisense; CATTCCATATTTTAGAGTTTCTCTC
>probe:Drosophila_2:1633631_at:415:91; Interrogation_Position=1590; Antisense; AGTTTCTCTCTACTTTTCTACTCAT
>probe:Drosophila_2:1633631_at:566:147; Interrogation_Position=1601; Antisense; ACTTTTCTACTCATTTGTCCTAATA
>probe:Drosophila_2:1633631_at:130:383; Interrogation_Position=1629; Antisense; GAACGAGCAAATTAATGACCCATAC
>probe:Drosophila_2:1633631_at:277:411; Interrogation_Position=1645; Antisense; GACCCATACACTTGTCATACTTTAA

Paste this into a BLAST search page for me
TTGCGCATGATGCTGCAAATGCTGCGAAATGCGGCCGGAGATGTTGCAAAAATGCCGCCGGAAATGTTGCTGGAAGAAATGCATCAAATGCTGCTGGAGAGAAATGTTGCTGGAAGTGTTGCTAAGAAGTGTTGCTAATGCTGCTGGAAACTGCTGGTGATGTTGCAAATGCCGCAGCTAATGCTGCTGGAAATGTTGCAGCAAGCAACATTTTCCATTCCATATCATTCCATATTTTAGAGTTTCTCTCAGTTTCTCTCTACTTTTCTACTCATACTTTTCTACTCATTTGTCCTAATAGAACGAGCAAATTAATGACCCATACGACCCATACACTTGTCATACTTTAA

Full Affymetrix probeset data:

Annotations for 1633631_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime