Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633632_at:

>probe:Drosophila_2:1633632_at:417:587; Interrogation_Position=1516; Antisense; TGGAGCAGCAACTTCGTCGATCTGC
>probe:Drosophila_2:1633632_at:596:451; Interrogation_Position=1534; Antisense; GATCTGCTGCAGAGGTTACTTTCCA
>probe:Drosophila_2:1633632_at:99:261; Interrogation_Position=1557; Antisense; CACCTATCCGGGTGCTAGGATCAGT
>probe:Drosophila_2:1633632_at:640:75; Interrogation_Position=1589; Antisense; AGGAGCTGCATCAAACGCCCATGTT
>probe:Drosophila_2:1633632_at:557:623; Interrogation_Position=1613; Antisense; TGCGCAACATTGACTTCCAGAGGGT
>probe:Drosophila_2:1633632_at:551:195; Interrogation_Position=1687; Antisense; AACTGTGATCCTTGCCTAGAACTGG
>probe:Drosophila_2:1633632_at:627:367; Interrogation_Position=1726; Antisense; GAATCGCGGCCCTTGCATAAAAAGA
>probe:Drosophila_2:1633632_at:627:435; Interrogation_Position=1770; Antisense; GAGGTCAGCACAACGCGACAGCGAT
>probe:Drosophila_2:1633632_at:178:425; Interrogation_Position=1798; Antisense; GAGACTGCACTGGTCAAAGAGTTCA
>probe:Drosophila_2:1633632_at:481:429; Interrogation_Position=1816; Antisense; GAGTTCATCGTTTACAACCGCTACA
>probe:Drosophila_2:1633632_at:540:175; Interrogation_Position=1875; Antisense; AAACGACTGGCAGCGCGAACTGGAA
>probe:Drosophila_2:1633632_at:724:323; Interrogation_Position=1889; Antisense; GCGAACTGGAACTGGCCATGGCCAA
>probe:Drosophila_2:1633632_at:341:723; Interrogation_Position=2027; Antisense; TTGAGTTCATTGATCGCACTCCTTC
>probe:Drosophila_2:1633632_at:514:269; Interrogation_Position=2088; Antisense; CATGCCGCAGAGTCCGTTTCAAAAA

Paste this into a BLAST search page for me
TGGAGCAGCAACTTCGTCGATCTGCGATCTGCTGCAGAGGTTACTTTCCACACCTATCCGGGTGCTAGGATCAGTAGGAGCTGCATCAAACGCCCATGTTTGCGCAACATTGACTTCCAGAGGGTAACTGTGATCCTTGCCTAGAACTGGGAATCGCGGCCCTTGCATAAAAAGAGAGGTCAGCACAACGCGACAGCGATGAGACTGCACTGGTCAAAGAGTTCAGAGTTCATCGTTTACAACCGCTACAAAACGACTGGCAGCGCGAACTGGAAGCGAACTGGAACTGGCCATGGCCAATTGAGTTCATTGATCGCACTCCTTCCATGCCGCAGAGTCCGTTTCAAAAA

Full Affymetrix probeset data:

Annotations for 1633632_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime