FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633634_at:

>probe:Drosophila_2:1633634_at:335:283; Interrogation_Position=1308; Antisense; CTGCACTTCGAGGAGAGCGGACCAC
>probe:Drosophila_2:1633634_at:683:503; Interrogation_Position=1348; Antisense; GTCCTGACTGCGAGAGCTGGCTGAA
>probe:Drosophila_2:1633634_at:663:555; Interrogation_Position=1373; Antisense; GGACGAGGACAATCTTAAGCAGCAT
>probe:Drosophila_2:1633634_at:15:659; Interrogation_Position=1388; Antisense; TAAGCAGCATTTGAGGCGCCACAAC
>probe:Drosophila_2:1633634_at:190:83; Interrogation_Position=1417; Antisense; AGGGCAAGCTGTTTATCTGCTCAGA
>probe:Drosophila_2:1633634_at:210:285; Interrogation_Position=1473; Antisense; CTGATTGGTCATAAGCGCTACTCCC
>probe:Drosophila_2:1633634_at:728:369; Interrogation_Position=1502; Antisense; GAATGTGATCTACACCTGCGAGCAG
>probe:Drosophila_2:1633634_at:436:657; Interrogation_Position=1559; Antisense; TAAGGAGCATATGGCGCAGCACACT
>probe:Drosophila_2:1633634_at:458:53; Interrogation_Position=1662; Antisense; ATGCATCCGGTGGAGTGGGACATCT
>probe:Drosophila_2:1633634_at:203:411; Interrogation_Position=1694; Antisense; GACGAAGACCGGTAGCTCACAGAAG
>probe:Drosophila_2:1633634_at:648:83; Interrogation_Position=1736; Antisense; AGTGGCGCAAATGTTCCGGGACGAT
>probe:Drosophila_2:1633634_at:336:409; Interrogation_Position=1755; Antisense; GACGATGCCGATGTCGCAGCTATTG
>probe:Drosophila_2:1633634_at:329:341; Interrogation_Position=1773; Antisense; GCTATTGCCAATGACTATTCGGGTT
>probe:Drosophila_2:1633634_at:48:293; Interrogation_Position=1822; Antisense; CGATTTGCGGAAACCATTGCTTAGT

Paste this into a BLAST search page for me
CTGCACTTCGAGGAGAGCGGACCACGTCCTGACTGCGAGAGCTGGCTGAAGGACGAGGACAATCTTAAGCAGCATTAAGCAGCATTTGAGGCGCCACAACAGGGCAAGCTGTTTATCTGCTCAGACTGATTGGTCATAAGCGCTACTCCCGAATGTGATCTACACCTGCGAGCAGTAAGGAGCATATGGCGCAGCACACTATGCATCCGGTGGAGTGGGACATCTGACGAAGACCGGTAGCTCACAGAAGAGTGGCGCAAATGTTCCGGGACGATGACGATGCCGATGTCGCAGCTATTGGCTATTGCCAATGACTATTCGGGTTCGATTTGCGGAAACCATTGCTTAGT

Full Affymetrix probeset data:

Annotations for 1633634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720