Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633636_at:

>probe:Drosophila_2:1633636_at:578:453; Interrogation_Position=1998; Antisense; GATAACCAGTGTGCCTACGACTAAG
>probe:Drosophila_2:1633636_at:48:449; Interrogation_Position=2074; Antisense; GATCCTGCCAAATCCTATCGGGATA
>probe:Drosophila_2:1633636_at:394:41; Interrogation_Position=2090; Antisense; ATCGGGATATCGTTCACAGCCATGA
>probe:Drosophila_2:1633636_at:432:387; Interrogation_Position=2164; Antisense; GAAACGGGTTTACTTAGGCATCTAG
>probe:Drosophila_2:1633636_at:338:345; Interrogation_Position=2181; Antisense; GCATCTAGGTTTTGCCTTTCATGTG
>probe:Drosophila_2:1633636_at:469:521; Interrogation_Position=2209; Antisense; GTGGCTGCTGCCTACAAGATCATTG
>probe:Drosophila_2:1633636_at:219:459; Interrogation_Position=2254; Antisense; GATATTTGCGATCTGACCGAAGTCA
>probe:Drosophila_2:1633636_at:614:373; Interrogation_Position=2272; Antisense; GAAGTCAGTATGTTTCCGCCACAAA
>probe:Drosophila_2:1633636_at:401:33; Interrogation_Position=2387; Antisense; ATCACTTTAATGTCTGGCACTCGAG
>probe:Drosophila_2:1633636_at:363:259; Interrogation_Position=2404; Antisense; CACTCGAGGAAACCGCCTTGTGTGA
>probe:Drosophila_2:1633636_at:433:103; Interrogation_Position=2438; Antisense; AGACCTCCGACCTGCATGTTGACAT
>probe:Drosophila_2:1633636_at:208:511; Interrogation_Position=2470; Antisense; GTGAGTTCGGCCCTGTTGATACTAC
>probe:Drosophila_2:1633636_at:179:605; Interrogation_Position=2486; Antisense; TGATACTACTTTTCAGCTACGCCAT
>probe:Drosophila_2:1633636_at:477:313; Interrogation_Position=2506; Antisense; GCCATCACCCTTATGATACTGGGCA

Paste this into a BLAST search page for me
GATAACCAGTGTGCCTACGACTAAGGATCCTGCCAAATCCTATCGGGATAATCGGGATATCGTTCACAGCCATGAGAAACGGGTTTACTTAGGCATCTAGGCATCTAGGTTTTGCCTTTCATGTGGTGGCTGCTGCCTACAAGATCATTGGATATTTGCGATCTGACCGAAGTCAGAAGTCAGTATGTTTCCGCCACAAAATCACTTTAATGTCTGGCACTCGAGCACTCGAGGAAACCGCCTTGTGTGAAGACCTCCGACCTGCATGTTGACATGTGAGTTCGGCCCTGTTGATACTACTGATACTACTTTTCAGCTACGCCATGCCATCACCCTTATGATACTGGGCA

Full Affymetrix probeset data:

Annotations for 1633636_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime