FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633637_at:

>probe:Drosophila_2:1633637_at:56:121; Interrogation_Position=272; Antisense; AGCTGACGGATGCTCCAACTTGGAT
>probe:Drosophila_2:1633637_at:282:9; Interrogation_Position=337; Antisense; ATTCCACATGTCTCGGTTTCAATTG
>probe:Drosophila_2:1633637_at:15:535; Interrogation_Position=391; Antisense; GGTGTAGTTAACAATCCCGCACAGA
>probe:Drosophila_2:1633637_at:225:247; Interrogation_Position=434; Antisense; AATTGGGCCAGGGTGCCTTTTGCAA
>probe:Drosophila_2:1633637_at:531:419; Interrogation_Position=477; Antisense; GAGCAGCTGTGAACATCTCAACGAT
>probe:Drosophila_2:1633637_at:68:571; Interrogation_Position=510; Antisense; GGCATACGAGGTTTGCTTGCTGCAC
>probe:Drosophila_2:1633637_at:654:621; Interrogation_Position=527; Antisense; TGCTGCACGCTCCAAAGATCCGGAA
>probe:Drosophila_2:1633637_at:673:673; Interrogation_Position=571; Antisense; TACCATGTGGGATCCAATGCCAGAA
>probe:Drosophila_2:1633637_at:142:213; Interrogation_Position=594; Antisense; AAGACTCCTGGCATATTCCGCTGTA
>probe:Drosophila_2:1633637_at:337:83; Interrogation_Position=618; Antisense; AGTGGATTCCCTTTGCATGGTGGCC
>probe:Drosophila_2:1633637_at:532:269; Interrogation_Position=633; Antisense; CATGGTGGCCGCAGGCAACTTGGAT
>probe:Drosophila_2:1633637_at:265:465; Interrogation_Position=688; Antisense; GATTGTGCAGCTGGCTATTTGCTCA
>probe:Drosophila_2:1633637_at:5:143; Interrogation_Position=746; Antisense; ACGGCGGACCCTTCGATATCATGAA
>probe:Drosophila_2:1633637_at:534:417; Interrogation_Position=817; Antisense; GAGCATCTTATTCGGAAGGCTGATC

Paste this into a BLAST search page for me
AGCTGACGGATGCTCCAACTTGGATATTCCACATGTCTCGGTTTCAATTGGGTGTAGTTAACAATCCCGCACAGAAATTGGGCCAGGGTGCCTTTTGCAAGAGCAGCTGTGAACATCTCAACGATGGCATACGAGGTTTGCTTGCTGCACTGCTGCACGCTCCAAAGATCCGGAATACCATGTGGGATCCAATGCCAGAAAAGACTCCTGGCATATTCCGCTGTAAGTGGATTCCCTTTGCATGGTGGCCCATGGTGGCCGCAGGCAACTTGGATGATTGTGCAGCTGGCTATTTGCTCAACGGCGGACCCTTCGATATCATGAAGAGCATCTTATTCGGAAGGCTGATC

Full Affymetrix probeset data:

Annotations for 1633637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720