Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633639_at:

>probe:Drosophila_2:1633639_at:286:93; Interrogation_Position=1069; Antisense; AGATAAGTGAGCTGCCCTTCACCGA
>probe:Drosophila_2:1633639_at:218:379; Interrogation_Position=1092; Antisense; GAAGCCTGCATCCATGAAACTTTGA
>probe:Drosophila_2:1633639_at:355:109; Interrogation_Position=1116; Antisense; AGAATTTTCTCACCTGTTCTGGCTG
>probe:Drosophila_2:1633639_at:364:583; Interrogation_Position=1135; Antisense; TGGCTGCCCGCAAGGTGGTAACTGA
>probe:Drosophila_2:1633639_at:267:195; Interrogation_Position=1154; Antisense; AACTGAGCCCTGTGAACTGACGAAC
>probe:Drosophila_2:1633639_at:436:601; Interrogation_Position=1214; Antisense; TGTAGTCATCATTCCTGTGAACGCC
>probe:Drosophila_2:1633639_at:36:73; Interrogation_Position=1264; Antisense; AGGAACCTCAATCGTTCAAGCCCGA
>probe:Drosophila_2:1633639_at:539:417; Interrogation_Position=1287; Antisense; GAGCGATTCCTGAACATCAATGGCG
>probe:Drosophila_2:1633639_at:49:645; Interrogation_Position=1331; Antisense; TCAGGGTCTATTCTTTGGGTTTGGC
>probe:Drosophila_2:1633639_at:122:63; Interrogation_Position=1357; Antisense; ATGGACCACGTATTTGCCCCGGTAT
>probe:Drosophila_2:1633639_at:116:623; Interrogation_Position=1381; Antisense; TGCGGTTTTCACTTACCCAAATCAA
>probe:Drosophila_2:1633639_at:194:173; Interrogation_Position=1404; Antisense; AAAGCTGCCCTGGTGGAAATCGTGC
>probe:Drosophila_2:1633639_at:536:723; Interrogation_Position=1477; Antisense; TTGATGATACCTACTTTATGCCAGC
>probe:Drosophila_2:1633639_at:520:287; Interrogation_Position=1511; Antisense; CGGCGTTTGGCTGGATTTTGTTGAA

Paste this into a BLAST search page for me
AGATAAGTGAGCTGCCCTTCACCGAGAAGCCTGCATCCATGAAACTTTGAAGAATTTTCTCACCTGTTCTGGCTGTGGCTGCCCGCAAGGTGGTAACTGAAACTGAGCCCTGTGAACTGACGAACTGTAGTCATCATTCCTGTGAACGCCAGGAACCTCAATCGTTCAAGCCCGAGAGCGATTCCTGAACATCAATGGCGTCAGGGTCTATTCTTTGGGTTTGGCATGGACCACGTATTTGCCCCGGTATTGCGGTTTTCACTTACCCAAATCAAAAAGCTGCCCTGGTGGAAATCGTGCTTGATGATACCTACTTTATGCCAGCCGGCGTTTGGCTGGATTTTGTTGAA

Full Affymetrix probeset data:

Annotations for 1633639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime