FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633644_at:

>probe:Drosophila_2:1633644_at:413:455; Interrogation_Position=1361; Antisense; GATCAATCCTTTTCTGCAACTACTT
>probe:Drosophila_2:1633644_at:221:201; Interrogation_Position=1398; Antisense; AACGCGGCTGCCGTGAATGCATGGA
>probe:Drosophila_2:1633644_at:566:51; Interrogation_Position=1414; Antisense; ATGCATGGATCCTGTTACGACTTTC
>probe:Drosophila_2:1633644_at:331:35; Interrogation_Position=1462; Antisense; ATCAGCGCGACTTCCAGAGACAGTT
>probe:Drosophila_2:1633644_at:397:423; Interrogation_Position=1478; Antisense; GAGACAGTTGGGACTCTTCCTCACA
>probe:Drosophila_2:1633644_at:407:113; Interrogation_Position=1504; Antisense; AGCAGAGATTACAGCGACGCCTTCA
>probe:Drosophila_2:1633644_at:648:149; Interrogation_Position=1545; Antisense; ACTTCGCTCGTGATGCGACTGCAAA
>probe:Drosophila_2:1633644_at:726:357; Interrogation_Position=1565; Antisense; GCAAATCTGCGAAATCCTGGGCCAA
>probe:Drosophila_2:1633644_at:574:485; Interrogation_Position=1644; Antisense; GTAGGCGTGCTAACACCCGACAAGA
>probe:Drosophila_2:1633644_at:65:525; Interrogation_Position=1682; Antisense; GGGCATTAATTTGGCTAGTCGGTAC
>probe:Drosophila_2:1633644_at:69:423; Interrogation_Position=1710; Antisense; GAGAAGCATCGCAGGTGCAAGCCCT
>probe:Drosophila_2:1633644_at:303:411; Interrogation_Position=1766; Antisense; GACGCGGTGCCAACAGTGCTTGCAA
>probe:Drosophila_2:1633644_at:204:43; Interrogation_Position=1792; Antisense; ATCGATGCGGCAACCACTTGATATC
>probe:Drosophila_2:1633644_at:411:605; Interrogation_Position=1810; Antisense; TGATATCCCGCTGCTACGAATGCGT

Paste this into a BLAST search page for me
GATCAATCCTTTTCTGCAACTACTTAACGCGGCTGCCGTGAATGCATGGAATGCATGGATCCTGTTACGACTTTCATCAGCGCGACTTCCAGAGACAGTTGAGACAGTTGGGACTCTTCCTCACAAGCAGAGATTACAGCGACGCCTTCAACTTCGCTCGTGATGCGACTGCAAAGCAAATCTGCGAAATCCTGGGCCAAGTAGGCGTGCTAACACCCGACAAGAGGGCATTAATTTGGCTAGTCGGTACGAGAAGCATCGCAGGTGCAAGCCCTGACGCGGTGCCAACAGTGCTTGCAAATCGATGCGGCAACCACTTGATATCTGATATCCCGCTGCTACGAATGCGT

Full Affymetrix probeset data:

Annotations for 1633644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720