Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633646_at:

>probe:Drosophila_2:1633646_at:663:243; Interrogation_Position=2577; Antisense; AATTACAACGTTTATGATACTCCAA
>probe:Drosophila_2:1633646_at:674:57; Interrogation_Position=2590; Antisense; ATGATACTCCAAAGATTCGCACTAT
>probe:Drosophila_2:1633646_at:641:215; Interrogation_Position=2601; Antisense; AAGATTCGCACTATAAAGCCCACGA
>probe:Drosophila_2:1633646_at:267:169; Interrogation_Position=2625; Antisense; AAAGTGGCCTAAAAATAGCTGACGC
>probe:Drosophila_2:1633646_at:6:243; Interrogation_Position=2638; Antisense; AATAGCTGACGCATTACCCATAGGC
>probe:Drosophila_2:1633646_at:687:607; Interrogation_Position=2644; Antisense; TGACGCATTACCCATAGGCGCTTCG
>probe:Drosophila_2:1633646_at:166:71; Interrogation_Position=2659; Antisense; AGGCGCTTCGCTTCTCAAGATAAAA
>probe:Drosophila_2:1633646_at:500:31; Interrogation_Position=2678; Antisense; ATAAAACCTGGCGTGCTCAACTCAA
>probe:Drosophila_2:1633646_at:620:567; Interrogation_Position=2741; Antisense; GGCATATAACCGATGTGTGACGTGA
>probe:Drosophila_2:1633646_at:570:595; Interrogation_Position=2756; Antisense; TGTGACGTGACATTGGCTCGTTCTA
>probe:Drosophila_2:1633646_at:298:573; Interrogation_Position=2770; Antisense; GGCTCGTTCTATTCACATACTTAAA
>probe:Drosophila_2:1633646_at:570:457; Interrogation_Position=2916; Antisense; GATAGTAAAACTGCATCTGCATCCA
>probe:Drosophila_2:1633646_at:390:347; Interrogation_Position=2928; Antisense; GCATCTGCATCCAAAGACACGAGAA
>probe:Drosophila_2:1633646_at:41:659; Interrogation_Position=3014; Antisense; TAACTGATGGGCATATACCGCATAT

Paste this into a BLAST search page for me
AATTACAACGTTTATGATACTCCAAATGATACTCCAAAGATTCGCACTATAAGATTCGCACTATAAAGCCCACGAAAAGTGGCCTAAAAATAGCTGACGCAATAGCTGACGCATTACCCATAGGCTGACGCATTACCCATAGGCGCTTCGAGGCGCTTCGCTTCTCAAGATAAAAATAAAACCTGGCGTGCTCAACTCAAGGCATATAACCGATGTGTGACGTGATGTGACGTGACATTGGCTCGTTCTAGGCTCGTTCTATTCACATACTTAAAGATAGTAAAACTGCATCTGCATCCAGCATCTGCATCCAAAGACACGAGAATAACTGATGGGCATATACCGCATAT

Full Affymetrix probeset data:

Annotations for 1633646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime