FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633647_at:

>probe:Drosophila_2:1633647_at:376:375; Interrogation_Position=136; Antisense; GAAGATCACAGAGAGACCAGCACCT
>probe:Drosophila_2:1633647_at:37:87; Interrogation_Position=18; Antisense; AGTGCTCATACTTCTTGTGCTGTTG
>probe:Drosophila_2:1633647_at:64:425; Interrogation_Position=223; Antisense; GAGACGGGCAATAGCATCATTCATG
>probe:Drosophila_2:1633647_at:576:557; Interrogation_Position=267; Antisense; GGACTTCGACACCAATCCAAATGGG
>probe:Drosophila_2:1633647_at:399:603; Interrogation_Position=293; Antisense; TGTTGGTTCAGCATGGCCAGTACTC
>probe:Drosophila_2:1633647_at:481:301; Interrogation_Position=329; Antisense; CCGAGGGAACTCTGGTCAATGTGCA
>probe:Drosophila_2:1633647_at:67:227; Interrogation_Position=346; Antisense; AATGTGCAGTACACGGCCGACGAGA
>probe:Drosophila_2:1633647_at:681:81; Interrogation_Position=379; Antisense; AGGGCCACAGGTGATCACATTCCTA
>probe:Drosophila_2:1633647_at:64:467; Interrogation_Position=39; Antisense; GTTGGCCATTTCCTGCCAAGGACAA
>probe:Drosophila_2:1633647_at:258:633; Interrogation_Position=405; Antisense; TCCGCCGGCTATTCCCGAGGAGATA
>probe:Drosophila_2:1633647_at:587:691; Interrogation_Position=438; Antisense; TTTGGATCAGATCTACGCTGGCATT
>probe:Drosophila_2:1633647_at:653:433; Interrogation_Position=489; Antisense; GAGGGCCAAGACAGATCCAGACTTT
>probe:Drosophila_2:1633647_at:589:553; Interrogation_Position=528; Antisense; GGAGCGACGCGTGGCCAACCAGAAT
>probe:Drosophila_2:1633647_at:351:371; Interrogation_Position=549; Antisense; GAATGGCCAGTACATCGGTCTGCTG

Paste this into a BLAST search page for me
GAAGATCACAGAGAGACCAGCACCTAGTGCTCATACTTCTTGTGCTGTTGGAGACGGGCAATAGCATCATTCATGGGACTTCGACACCAATCCAAATGGGTGTTGGTTCAGCATGGCCAGTACTCCCGAGGGAACTCTGGTCAATGTGCAAATGTGCAGTACACGGCCGACGAGAAGGGCCACAGGTGATCACATTCCTAGTTGGCCATTTCCTGCCAAGGACAATCCGCCGGCTATTCCCGAGGAGATATTTGGATCAGATCTACGCTGGCATTGAGGGCCAAGACAGATCCAGACTTTGGAGCGACGCGTGGCCAACCAGAATGAATGGCCAGTACATCGGTCTGCTG

Full Affymetrix probeset data:

Annotations for 1633647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720