Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633648_at:

>probe:Drosophila_2:1633648_at:563:667; Interrogation_Position=7454; Antisense; TACATAGGAATAACCGACTCGCTGT
>probe:Drosophila_2:1633648_at:477:295; Interrogation_Position=7468; Antisense; CGACTCGCTGTTTTCTTAGGGATAA
>probe:Drosophila_2:1633648_at:715:463; Interrogation_Position=7498; Antisense; GATTGCACTCGAACTAAATACTCCA
>probe:Drosophila_2:1633648_at:140:165; Interrogation_Position=7513; Antisense; AAATACTCCACGAGACAGCTCTGTG
>probe:Drosophila_2:1633648_at:500:597; Interrogation_Position=7534; Antisense; TGTGCTCCTCGCAAATCTTGTATGT
>probe:Drosophila_2:1633648_at:58:165; Interrogation_Position=7546; Antisense; AAATCTTGTATGTCTTCCCCAGCTT
>probe:Drosophila_2:1633648_at:722:343; Interrogation_Position=7567; Antisense; GCTTGTCCTGACCACTGTTGAATGT
>probe:Drosophila_2:1633648_at:639:367; Interrogation_Position=7586; Antisense; GAATGTCCTTGGTTCGATACGAATT
>probe:Drosophila_2:1633648_at:665:103; Interrogation_Position=7645; Antisense; AGACCTAGCGCACTTGTCGGTGGAA
>probe:Drosophila_2:1633648_at:214:107; Interrogation_Position=7772; Antisense; AGAACCGATAACTTGCAGCTAGATT
>probe:Drosophila_2:1633648_at:391:603; Interrogation_Position=7804; Antisense; TGCTTGTTTTACTCCACTGTGTTTA
>probe:Drosophila_2:1633648_at:431:395; Interrogation_Position=7915; Antisense; TGCCCGTCATTCGACCTTAACGTTA
>probe:Drosophila_2:1633648_at:206:385; Interrogation_Position=7954; Antisense; GAACAGCGGCTGAAGGCGACGACAC
>probe:Drosophila_2:1633648_at:569:61; Interrogation_Position=7967; Antisense; AGGCGACGACACACAAGACTTGAAT

Paste this into a BLAST search page for me
TACATAGGAATAACCGACTCGCTGTCGACTCGCTGTTTTCTTAGGGATAAGATTGCACTCGAACTAAATACTCCAAAATACTCCACGAGACAGCTCTGTGTGTGCTCCTCGCAAATCTTGTATGTAAATCTTGTATGTCTTCCCCAGCTTGCTTGTCCTGACCACTGTTGAATGTGAATGTCCTTGGTTCGATACGAATTAGACCTAGCGCACTTGTCGGTGGAAAGAACCGATAACTTGCAGCTAGATTTGCTTGTTTTACTCCACTGTGTTTATGCCCGTCATTCGACCTTAACGTTAGAACAGCGGCTGAAGGCGACGACACAGGCGACGACACACAAGACTTGAAT

Full Affymetrix probeset data:

Annotations for 1633648_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime