Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633651_at:

>probe:Drosophila_2:1633651_at:454:177; Interrogation_Position=1018; Antisense; AAACGGCCAGCACTTTTCGAGTAGG
>probe:Drosophila_2:1633651_at:139:485; Interrogation_Position=1038; Antisense; GTAGGCGATGTTGAGCGATTTGATA
>probe:Drosophila_2:1633651_at:281:457; Interrogation_Position=1059; Antisense; GATAGATCTTGATGGAAGTTCCTCT
>probe:Drosophila_2:1633651_at:659:563; Interrogation_Position=1072; Antisense; GGAAGTTCCTCTTAGAGCTACAAAA
>probe:Drosophila_2:1633651_at:195:35; Interrogation_Position=1182; Antisense; ATCACTGGGCTGGAGATTATTTCAA
>probe:Drosophila_2:1633651_at:685:427; Interrogation_Position=1194; Antisense; GAGATTATTTCAAACACGGACACAC
>probe:Drosophila_2:1633651_at:466:179; Interrogation_Position=1222; Antisense; AAACACACGGCTAAGAATTTGCTCT
>probe:Drosophila_2:1633651_at:256:365; Interrogation_Position=1236; Antisense; GAATTTGCTCTGTTTGTCGACACAA
>probe:Drosophila_2:1633651_at:727:501; Interrogation_Position=1251; Antisense; GTCGACACAAAATTTCAGCTTAATG
>probe:Drosophila_2:1633651_at:345:343; Interrogation_Position=1268; Antisense; GCTTAATGTATAACGAGACTTGCGA
>probe:Drosophila_2:1633651_at:108:369; Interrogation_Position=1321; Antisense; GAATGAGATGCTTCGATGAGTGTGT
>probe:Drosophila_2:1633651_at:460:517; Interrogation_Position=1340; Antisense; GTGTGTGGATTCAATTGTACTATTT
>probe:Drosophila_2:1633651_at:389:17; Interrogation_Position=1508; Antisense; ATTTCAGTTGTGGTACATCTACGTA
>probe:Drosophila_2:1633651_at:710:541; Interrogation_Position=997; Antisense; GGATTCCTGGGAATGCGAGGCAAAC

Paste this into a BLAST search page for me
AAACGGCCAGCACTTTTCGAGTAGGGTAGGCGATGTTGAGCGATTTGATAGATAGATCTTGATGGAAGTTCCTCTGGAAGTTCCTCTTAGAGCTACAAAAATCACTGGGCTGGAGATTATTTCAAGAGATTATTTCAAACACGGACACACAAACACACGGCTAAGAATTTGCTCTGAATTTGCTCTGTTTGTCGACACAAGTCGACACAAAATTTCAGCTTAATGGCTTAATGTATAACGAGACTTGCGAGAATGAGATGCTTCGATGAGTGTGTGTGTGTGGATTCAATTGTACTATTTATTTCAGTTGTGGTACATCTACGTAGGATTCCTGGGAATGCGAGGCAAAC

Full Affymetrix probeset data:

Annotations for 1633651_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime