FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633652_at:

>probe:Drosophila_2:1633652_at:393:171; Interrogation_Position=113; Antisense; AAAGTGAAGTGAAGCCCGGTGAAAT
>probe:Drosophila_2:1633652_at:308:169; Interrogation_Position=134; Antisense; AAATGGGACGCATCTTGGCCGTTCT
>probe:Drosophila_2:1633652_at:347:471; Interrogation_Position=154; Antisense; GTTCTTCTGACCCTGATAGTGATCA
>probe:Drosophila_2:1633652_at:627:679; Interrogation_Position=170; Antisense; TAGTGATCAGCTTTGCCATTGTCGT
>probe:Drosophila_2:1633652_at:268:597; Interrogation_Position=189; Antisense; TGTCGTTGTGGCTCGCATCCTGGTA
>probe:Drosophila_2:1633652_at:658:685; Interrogation_Position=212; Antisense; TATCTCTGGCCATACCAACATTGGT
>probe:Drosophila_2:1633652_at:262:5; Interrogation_Position=238; Antisense; ATTGTGGCACTTTTGATGGCATACC
>probe:Drosophila_2:1633652_at:361:693; Interrogation_Position=249; Antisense; TTTGATGGCATACCGTTTCGTCACT
>probe:Drosophila_2:1633652_at:726:477; Interrogation_Position=263; Antisense; GTTTCGTCACTCTTTCGGAAATGAA
>probe:Drosophila_2:1633652_at:444:171; Interrogation_Position=286; Antisense; AAAGATGGTCTCATGGCTGTGCCCG
>probe:Drosophila_2:1633652_at:150:69; Interrogation_Position=298; Antisense; ATGGCTGTGCCCGATATTCTAACAT
>probe:Drosophila_2:1633652_at:133:487; Interrogation_Position=326; Antisense; GTACGAACTTTATATCTGGCCTTTT
>probe:Drosophila_2:1633652_at:135:3; Interrogation_Position=406; Antisense; ATTGGATACTCTTCTGCTATTCATA
>probe:Drosophila_2:1633652_at:370:721; Interrogation_Position=89; Antisense; TTGACCGTTTGGATGCGTGGACTAA

Paste this into a BLAST search page for me
AAAGTGAAGTGAAGCCCGGTGAAATAAATGGGACGCATCTTGGCCGTTCTGTTCTTCTGACCCTGATAGTGATCATAGTGATCAGCTTTGCCATTGTCGTTGTCGTTGTGGCTCGCATCCTGGTATATCTCTGGCCATACCAACATTGGTATTGTGGCACTTTTGATGGCATACCTTTGATGGCATACCGTTTCGTCACTGTTTCGTCACTCTTTCGGAAATGAAAAAGATGGTCTCATGGCTGTGCCCGATGGCTGTGCCCGATATTCTAACATGTACGAACTTTATATCTGGCCTTTTATTGGATACTCTTCTGCTATTCATATTGACCGTTTGGATGCGTGGACTAA

Full Affymetrix probeset data:

Annotations for 1633652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720