FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633653_at:

>probe:Drosophila_2:1633653_at:75:245; Interrogation_Position=122; Antisense; AATTCGCGGGCATCGAGTTCGGTGA
>probe:Drosophila_2:1633653_at:518:373; Interrogation_Position=195; Antisense; GAAGTCGCCGTATCGAATGCTCCTA
>probe:Drosophila_2:1633653_at:605:107; Interrogation_Position=224; Antisense; AGAAGCTCTACGAGTTCGCCATTCT
>probe:Drosophila_2:1633653_at:55:333; Interrogation_Position=278; Antisense; GCGGCTACCTGTTCAGCGTGGTGAA
>probe:Drosophila_2:1633653_at:456:43; Interrogation_Position=339; Antisense; ATCGCCCGTCGTGAAGAACAGCTAC
>probe:Drosophila_2:1633653_at:492:117; Interrogation_Position=358; Antisense; AGCTACAACGTATCGCTGGTCTACA
>probe:Drosophila_2:1633653_at:73:555; Interrogation_Position=390; Antisense; GGACCAGAACATCGGCCGCAAGTTG
>probe:Drosophila_2:1633653_at:327:559; Interrogation_Position=441; Antisense; GGACAAGTGGAACTCGATTGCCCTC
>probe:Drosophila_2:1633653_at:51:171; Interrogation_Position=481; Antisense; AAAGTGTCCTTCTACTACGATTGCG
>probe:Drosophila_2:1633653_at:683:589; Interrogation_Position=524; Antisense; TGGTCACCAGGGAGCCCATTGAATT
>probe:Drosophila_2:1633653_at:390:363; Interrogation_Position=544; Antisense; GAATTGGTCTTCGATTCGGCGTCCA
>probe:Drosophila_2:1633653_at:505:329; Interrogation_Position=562; Antisense; GCGTCCACTCTGTATATTGGCCAGG
>probe:Drosophila_2:1633653_at:323:573; Interrogation_Position=628; Antisense; GGCGGCCAATTTGATTATGCCTTTG
>probe:Drosophila_2:1633653_at:335:581; Interrogation_Position=83; Antisense; TGGCCGAATACACACTGACCGACAT

Paste this into a BLAST search page for me
AATTCGCGGGCATCGAGTTCGGTGAGAAGTCGCCGTATCGAATGCTCCTAAGAAGCTCTACGAGTTCGCCATTCTGCGGCTACCTGTTCAGCGTGGTGAAATCGCCCGTCGTGAAGAACAGCTACAGCTACAACGTATCGCTGGTCTACAGGACCAGAACATCGGCCGCAAGTTGGGACAAGTGGAACTCGATTGCCCTCAAAGTGTCCTTCTACTACGATTGCGTGGTCACCAGGGAGCCCATTGAATTGAATTGGTCTTCGATTCGGCGTCCAGCGTCCACTCTGTATATTGGCCAGGGGCGGCCAATTTGATTATGCCTTTGTGGCCGAATACACACTGACCGACAT

Full Affymetrix probeset data:

Annotations for 1633653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720