Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633656_at:

>probe:Drosophila_2:1633656_at:174:387; Interrogation_Position=1655; Antisense; GAACAAGTGGCAAATCCACGCCTGC
>probe:Drosophila_2:1633656_at:466:313; Interrogation_Position=1674; Antisense; GCCTGCCCTTTCTTCCAAGGGAAAG
>probe:Drosophila_2:1633656_at:301:221; Interrogation_Position=1690; Antisense; AAGGGAAAGGACTCACCTGCACCAG
>probe:Drosophila_2:1633656_at:518:313; Interrogation_Position=1750; Antisense; GCCTCGCCAAAAAAGATCCCCAATG
>probe:Drosophila_2:1633656_at:169:411; Interrogation_Position=1819; Antisense; GACCCCGAGGATAAGAAGGCTTTAT
>probe:Drosophila_2:1633656_at:151:429; Interrogation_Position=1855; Antisense; GAGTTGGAAAGCTACCACCAGGCCT
>probe:Drosophila_2:1633656_at:519:577; Interrogation_Position=1875; Antisense; GGCCTTGGAGTACCTAAAACCGCTG
>probe:Drosophila_2:1633656_at:435:333; Interrogation_Position=1896; Antisense; GCTGGAGGACTTCGTGCTCTTCAAG
>probe:Drosophila_2:1633656_at:427:383; Interrogation_Position=1923; Antisense; GAACTTTCGGGCTATTGGCTTGCTG
>probe:Drosophila_2:1633656_at:122:569; Interrogation_Position=1939; Antisense; GGCTTGCTGTCCCAATTGGAACTGG
>probe:Drosophila_2:1633656_at:333:69; Interrogation_Position=1982; Antisense; AGGCCACACTGGTCGAGGGTTAAGA
>probe:Drosophila_2:1633656_at:216:429; Interrogation_Position=2005; Antisense; GAGTTTTCTAATCGCGGACCAGGAC
>probe:Drosophila_2:1633656_at:704:633; Interrogation_Position=2087; Antisense; TCGTACTACCGCCAAAACAGTTGCT
>probe:Drosophila_2:1633656_at:606:209; Interrogation_Position=2122; Antisense; AAGAATCTCCACTCGCATAAAGCTG

Paste this into a BLAST search page for me
GAACAAGTGGCAAATCCACGCCTGCGCCTGCCCTTTCTTCCAAGGGAAAGAAGGGAAAGGACTCACCTGCACCAGGCCTCGCCAAAAAAGATCCCCAATGGACCCCGAGGATAAGAAGGCTTTATGAGTTGGAAAGCTACCACCAGGCCTGGCCTTGGAGTACCTAAAACCGCTGGCTGGAGGACTTCGTGCTCTTCAAGGAACTTTCGGGCTATTGGCTTGCTGGGCTTGCTGTCCCAATTGGAACTGGAGGCCACACTGGTCGAGGGTTAAGAGAGTTTTCTAATCGCGGACCAGGACTCGTACTACCGCCAAAACAGTTGCTAAGAATCTCCACTCGCATAAAGCTG

Full Affymetrix probeset data:

Annotations for 1633656_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime