FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633657_at:

>probe:Drosophila_2:1633657_at:703:87; Interrogation_Position=1976; Antisense; AGTCCCTGATGATGTGCACCTGTCG
>probe:Drosophila_2:1633657_at:154:329; Interrogation_Position=2055; Antisense; GCGTTTTATAGAGCCATGTCCCGAC
>probe:Drosophila_2:1633657_at:425:413; Interrogation_Position=2077; Antisense; GACCACTTGGTGCTTACCGACACAA
>probe:Drosophila_2:1633657_at:516:93; Interrogation_Position=2117; Antisense; AGTTCGATCTGGATGTGACTCCGCC
>probe:Drosophila_2:1633657_at:414:673; Interrogation_Position=2154; Antisense; TAGACCGAAGCGCAAAGCCCTTAGG
>probe:Drosophila_2:1633657_at:680:509; Interrogation_Position=2185; Antisense; GTGAATCATAGCACCCAGACTGCAA
>probe:Drosophila_2:1633657_at:618:371; Interrogation_Position=2211; Antisense; GAAGGAGCCACCAGTTATACCGCCT
>probe:Drosophila_2:1633657_at:116:89; Interrogation_Position=2244; Antisense; AGTAGCCCACAATCACTTCTATAGG
>probe:Drosophila_2:1633657_at:136:687; Interrogation_Position=2263; Antisense; TATAGGGCCTACGATTGCGCAGCAG
>probe:Drosophila_2:1633657_at:270:65; Interrogation_Position=2299; Antisense; ATGGGCACAGCCTTCGGCGATAATA
>probe:Drosophila_2:1633657_at:117:523; Interrogation_Position=2366; Antisense; GTGGCCAGCATGGAAAGCCCGTAAT
>probe:Drosophila_2:1633657_at:533:491; Interrogation_Position=2386; Antisense; GTAATCTGGCGACACCCGAAGGTGT
>probe:Drosophila_2:1633657_at:561:585; Interrogation_Position=2442; Antisense; TGGAACCGCTAGGAACGCCATCGAT
>probe:Drosophila_2:1633657_at:725:265; Interrogation_Position=2460; Antisense; CATCGATCCTTACCGGTATACCAAA

Paste this into a BLAST search page for me
AGTCCCTGATGATGTGCACCTGTCGGCGTTTTATAGAGCCATGTCCCGACGACCACTTGGTGCTTACCGACACAAAGTTCGATCTGGATGTGACTCCGCCTAGACCGAAGCGCAAAGCCCTTAGGGTGAATCATAGCACCCAGACTGCAAGAAGGAGCCACCAGTTATACCGCCTAGTAGCCCACAATCACTTCTATAGGTATAGGGCCTACGATTGCGCAGCAGATGGGCACAGCCTTCGGCGATAATAGTGGCCAGCATGGAAAGCCCGTAATGTAATCTGGCGACACCCGAAGGTGTTGGAACCGCTAGGAACGCCATCGATCATCGATCCTTACCGGTATACCAAA

Full Affymetrix probeset data:

Annotations for 1633657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720