Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633658_a_at:

>probe:Drosophila_2:1633658_a_at:382:641; Interrogation_Position=514; Antisense; TCGGCGGTTGCATCTTTGCAGGTAG
>probe:Drosophila_2:1633658_a_at:54:543; Interrogation_Position=538; Antisense; GGATTCCTCGGAGAGTTCCACGCAA
>probe:Drosophila_2:1633658_a_at:593:535; Interrogation_Position=582; Antisense; GGTAGCCATTTGTAGCCAATCTCAG
>probe:Drosophila_2:1633658_a_at:255:237; Interrogation_Position=599; Antisense; AATCTCAGGGTCTAGCTCTCATCTA
>probe:Drosophila_2:1633658_a_at:108:593; Interrogation_Position=632; Antisense; TGGTGGCCATGGCTATTCTGCCCAA
>probe:Drosophila_2:1633658_a_at:608:651; Interrogation_Position=662; Antisense; TCAATGTGGACCTCAGCAGCAGCTA
>probe:Drosophila_2:1633658_a_at:565:263; Interrogation_Position=678; Antisense; CAGCAGCTACAACCTACGCGTGTGG
>probe:Drosophila_2:1633658_a_at:85:135; Interrogation_Position=693; Antisense; ACGCGTGTGGCGATTCCTAATGATG
>probe:Drosophila_2:1633658_a_at:429:471; Interrogation_Position=717; Antisense; GTTCTTCATGATTCCCGGCTGGTTG
>probe:Drosophila_2:1633658_a_at:386:581; Interrogation_Position=740; Antisense; TGGCCCTCGTCGGAATTTGTCTGGT
>probe:Drosophila_2:1633658_a_at:152:17; Interrogation_Position=779; Antisense; ATTTTCTCATGTCTGTCAATCGGCC
>probe:Drosophila_2:1633658_a_at:565:321; Interrogation_Position=811; Antisense; GCCCTCCTGGCCCTTAAATGGATAT
>probe:Drosophila_2:1633658_a_at:29:477; Interrogation_Position=939; Antisense; GTATAAGCTGCTCTTTTCCAAACCT
>probe:Drosophila_2:1633658_a_at:720:685; Interrogation_Position=953; Antisense; TTTCCAAACCTCACGTCTTCAAGTT

Paste this into a BLAST search page for me
TCGGCGGTTGCATCTTTGCAGGTAGGGATTCCTCGGAGAGTTCCACGCAAGGTAGCCATTTGTAGCCAATCTCAGAATCTCAGGGTCTAGCTCTCATCTATGGTGGCCATGGCTATTCTGCCCAATCAATGTGGACCTCAGCAGCAGCTACAGCAGCTACAACCTACGCGTGTGGACGCGTGTGGCGATTCCTAATGATGGTTCTTCATGATTCCCGGCTGGTTGTGGCCCTCGTCGGAATTTGTCTGGTATTTTCTCATGTCTGTCAATCGGCCGCCCTCCTGGCCCTTAAATGGATATGTATAAGCTGCTCTTTTCCAAACCTTTTCCAAACCTCACGTCTTCAAGTT

Full Affymetrix probeset data:

Annotations for 1633658_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime