Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633659_at:

>probe:Drosophila_2:1633659_at:322:555; Interrogation_Position=1371; Antisense; GGACCAGGAGCTTTTGATCCCAATC
>probe:Drosophila_2:1633659_at:631:715; Interrogation_Position=1384; Antisense; TTGATCCCAATCAGCGACAGTCCGA
>probe:Drosophila_2:1633659_at:254:275; Interrogation_Position=1415; Antisense; CATTGGAGCCCAATTGGCAGCGGGA
>probe:Drosophila_2:1633659_at:479:117; Interrogation_Position=1468; Antisense; AGCGCAATCGATCCAACTACCAGGG
>probe:Drosophila_2:1633659_at:635:147; Interrogation_Position=1483; Antisense; ACTACCAGGGTCTCAATGTGCTGAA
>probe:Drosophila_2:1633659_at:694:103; Interrogation_Position=1583; Antisense; AGACGGCAACTTCTACAGCGATCCT
>probe:Drosophila_2:1633659_at:449:449; Interrogation_Position=1602; Antisense; GATCCTCATCATGGACACCAGCGGG
>probe:Drosophila_2:1633659_at:705:261; Interrogation_Position=1620; Antisense; CAGCGGGCTTTGGTATCGGTTAATC
>probe:Drosophila_2:1633659_at:586:653; Interrogation_Position=1640; Antisense; TAATCCTAATCAGCGTTCAGTCCTT
>probe:Drosophila_2:1633659_at:335:473; Interrogation_Position=1654; Antisense; GTTCAGTCCTTATACCCGATGACGA
>probe:Drosophila_2:1633659_at:48:19; Interrogation_Position=1706; Antisense; ATTTCTGGGCTTTGCGGCTAGTAAC
>probe:Drosophila_2:1633659_at:670:185; Interrogation_Position=1728; Antisense; AACAAGCAGTCCTCTTATGTGGTTG
>probe:Drosophila_2:1633659_at:625:595; Interrogation_Position=1745; Antisense; TGTGGTTGCTCCCAAACAACTGCGA
>probe:Drosophila_2:1633659_at:246:663; Interrogation_Position=1808; Antisense; TAAAACATCTGCTTCGGAGTACGAC

Paste this into a BLAST search page for me
GGACCAGGAGCTTTTGATCCCAATCTTGATCCCAATCAGCGACAGTCCGACATTGGAGCCCAATTGGCAGCGGGAAGCGCAATCGATCCAACTACCAGGGACTACCAGGGTCTCAATGTGCTGAAAGACGGCAACTTCTACAGCGATCCTGATCCTCATCATGGACACCAGCGGGCAGCGGGCTTTGGTATCGGTTAATCTAATCCTAATCAGCGTTCAGTCCTTGTTCAGTCCTTATACCCGATGACGAATTTCTGGGCTTTGCGGCTAGTAACAACAAGCAGTCCTCTTATGTGGTTGTGTGGTTGCTCCCAAACAACTGCGATAAAACATCTGCTTCGGAGTACGAC

Full Affymetrix probeset data:

Annotations for 1633659_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime