Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633660_at:

>probe:Drosophila_2:1633660_at:319:689; Interrogation_Position=1017; Antisense; TTTGGCGGCATATAGCTGGACCACT
>probe:Drosophila_2:1633660_at:229:469; Interrogation_Position=1044; Antisense; GTTCCGCCTTAACCCAGATTTATAT
>probe:Drosophila_2:1633660_at:236:463; Interrogation_Position=1094; Antisense; GTTGAAGATTTCACCGCCATAGAAG
>probe:Drosophila_2:1633660_at:219:553; Interrogation_Position=1150; Antisense; GGAGCTGCCCTACTATGCCAAATTT
>probe:Drosophila_2:1633660_at:557:163; Interrogation_Position=1169; Antisense; AAATTTCTGTTGATCGCTGCCTTCT
>probe:Drosophila_2:1633660_at:189:207; Interrogation_Position=1223; Antisense; AAGCGATTGTTCGTCAAGCACCATG
>probe:Drosophila_2:1633660_at:35:529; Interrogation_Position=1318; Antisense; GGGACCCAAATCCTTTAGCATCGAT
>probe:Drosophila_2:1633660_at:95:707; Interrogation_Position=1332; Antisense; TTAGCATCGATCGTTTGCTGGCCAT
>probe:Drosophila_2:1633660_at:726:591; Interrogation_Position=1422; Antisense; TGGTGCACCTCAATCTACTAAGCTT
>probe:Drosophila_2:1633660_at:538:659; Interrogation_Position=1440; Antisense; TAAGCTTCGTCTCCGGCGAACAAAA
>probe:Drosophila_2:1633660_at:116:373; Interrogation_Position=1472; Antisense; GAAGGTTCCGCTAGGCTGCAGTGCA
>probe:Drosophila_2:1633660_at:648:353; Interrogation_Position=1494; Antisense; GCACCATTGGCTTGGAGTTTGTCCT
>probe:Drosophila_2:1633660_at:632:517; Interrogation_Position=1532; Antisense; GTGGTGGGCTTTAATGTCCGCCAAT
>probe:Drosophila_2:1633660_at:510:299; Interrogation_Position=1550; Antisense; CGCCAATATCTCTGCGACTTTATGT

Paste this into a BLAST search page for me
TTTGGCGGCATATAGCTGGACCACTGTTCCGCCTTAACCCAGATTTATATGTTGAAGATTTCACCGCCATAGAAGGGAGCTGCCCTACTATGCCAAATTTAAATTTCTGTTGATCGCTGCCTTCTAAGCGATTGTTCGTCAAGCACCATGGGGACCCAAATCCTTTAGCATCGATTTAGCATCGATCGTTTGCTGGCCATTGGTGCACCTCAATCTACTAAGCTTTAAGCTTCGTCTCCGGCGAACAAAAGAAGGTTCCGCTAGGCTGCAGTGCAGCACCATTGGCTTGGAGTTTGTCCTGTGGTGGGCTTTAATGTCCGCCAATCGCCAATATCTCTGCGACTTTATGT

Full Affymetrix probeset data:

Annotations for 1633660_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime