FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633661_at:

>probe:Drosophila_2:1633661_at:710:129; Interrogation_Position=1017; Antisense; ACCTACTTCGGAATGTGCGTGGCCA
>probe:Drosophila_2:1633661_at:520:131; Interrogation_Position=1041; Antisense; ACCTGTGTCATCTTCCAGAGCTCTA
>probe:Drosophila_2:1633661_at:34:265; Interrogation_Position=1056; Antisense; CAGAGCTCTACTCATATTGCCTGGG
>probe:Drosophila_2:1633661_at:711:265; Interrogation_Position=1105; Antisense; CAGGGTACATTGCTGTTTCCGAGTA
>probe:Drosophila_2:1633661_at:668:573; Interrogation_Position=1152; Antisense; GGCGGCCACCAACCCGAAATAGATA
>probe:Drosophila_2:1633661_at:399:401; Interrogation_Position=1222; Antisense; GACATGTCAACATTGCTTTCCTTTT
>probe:Drosophila_2:1633661_at:379:701; Interrogation_Position=1310; Antisense; TTTTGTACTTCGTTTGCAGTCCGCA
>probe:Drosophila_2:1633661_at:631:349; Interrogation_Position=1325; Antisense; GCAGTCCGCAGTGATTCAAACTCCA
>probe:Drosophila_2:1633661_at:546:651; Interrogation_Position=1340; Antisense; TCAAACTCCACGGTGCTCGGTGAAG
>probe:Drosophila_2:1633661_at:616:337; Interrogation_Position=1354; Antisense; GCTCGGTGAAGAGTCCACGCACGAA
>probe:Drosophila_2:1633661_at:41:177; Interrogation_Position=1398; Antisense; AAACGCACACCTTTTGTAGCCAATT
>probe:Drosophila_2:1633661_at:22:173; Interrogation_Position=1478; Antisense; AAAGCAGGGCATGACCATATTTTTT
>probe:Drosophila_2:1633661_at:579:703; Interrogation_Position=1502; Antisense; TTACACGTACCACACTTAGATATTT
>probe:Drosophila_2:1633661_at:601:205; Interrogation_Position=998; Antisense; AAGCTTTACGCGAATGCTCACCTAC

Paste this into a BLAST search page for me
ACCTACTTCGGAATGTGCGTGGCCAACCTGTGTCATCTTCCAGAGCTCTACAGAGCTCTACTCATATTGCCTGGGCAGGGTACATTGCTGTTTCCGAGTAGGCGGCCACCAACCCGAAATAGATAGACATGTCAACATTGCTTTCCTTTTTTTTGTACTTCGTTTGCAGTCCGCAGCAGTCCGCAGTGATTCAAACTCCATCAAACTCCACGGTGCTCGGTGAAGGCTCGGTGAAGAGTCCACGCACGAAAAACGCACACCTTTTGTAGCCAATTAAAGCAGGGCATGACCATATTTTTTTTACACGTACCACACTTAGATATTTAAGCTTTACGCGAATGCTCACCTAC

Full Affymetrix probeset data:

Annotations for 1633661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720