Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633662_a_at:

>probe:Drosophila_2:1633662_a_at:89:115; Interrogation_Position=1026; Antisense; AGCAGCTTATCCGACTCGATGGAAA
>probe:Drosophila_2:1633662_a_at:257:231; Interrogation_Position=1062; Antisense; AATGTCTCCAAACGCAGCCAGGGCA
>probe:Drosophila_2:1633662_a_at:578:213; Interrogation_Position=618; Antisense; AAGATGCATCCCATACTGCGGGTGA
>probe:Drosophila_2:1633662_a_at:271:495; Interrogation_Position=651; Antisense; GTCAAGTGCCACGATTTTTACAACA
>probe:Drosophila_2:1633662_a_at:728:663; Interrogation_Position=669; Antisense; TACAACAGCGGCGAGTTCTCCAAGG
>probe:Drosophila_2:1633662_a_at:418:77; Interrogation_Position=697; Antisense; AGGATGGCTCTGAGCTGTACTGCCG
>probe:Drosophila_2:1633662_a_at:70:575; Interrogation_Position=735; Antisense; GGCGGCGAGGTATACTGCTGCTCCA
>probe:Drosophila_2:1633662_a_at:501:497; Interrogation_Position=771; Antisense; GTCTTCTGCAAGTCGTGCATCGTGA
>probe:Drosophila_2:1633662_a_at:312:613; Interrogation_Position=793; Antisense; TGAAGAACCTCTCCAAGGGCGTCAT
>probe:Drosophila_2:1633662_a_at:472:523; Interrogation_Position=809; Antisense; GGGCGTCATCGTGGACATCGAGCAA
>probe:Drosophila_2:1633662_a_at:392:627; Interrogation_Position=864; Antisense; TCCAAGATCCTGTGGCCACTACGAG
>probe:Drosophila_2:1633662_a_at:63:595; Interrogation_Position=897; Antisense; TGGGCGCTGGTCAACTATCTTCAGA
>probe:Drosophila_2:1633662_a_at:128:549; Interrogation_Position=962; Antisense; GGAGGCCCGACGTCAAATGCTTAAG
>probe:Drosophila_2:1633662_a_at:483:263; Interrogation_Position=992; Antisense; CAGCAATTGCTGTCGCTTGGCGAAG

Paste this into a BLAST search page for me
AGCAGCTTATCCGACTCGATGGAAAAATGTCTCCAAACGCAGCCAGGGCAAAGATGCATCCCATACTGCGGGTGAGTCAAGTGCCACGATTTTTACAACATACAACAGCGGCGAGTTCTCCAAGGAGGATGGCTCTGAGCTGTACTGCCGGGCGGCGAGGTATACTGCTGCTCCAGTCTTCTGCAAGTCGTGCATCGTGATGAAGAACCTCTCCAAGGGCGTCATGGGCGTCATCGTGGACATCGAGCAATCCAAGATCCTGTGGCCACTACGAGTGGGCGCTGGTCAACTATCTTCAGAGGAGGCCCGACGTCAAATGCTTAAGCAGCAATTGCTGTCGCTTGGCGAAG

Full Affymetrix probeset data:

Annotations for 1633662_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime