FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633664_at:

>probe:Drosophila_2:1633664_at:694:565; Interrogation_Position=1027; Antisense; GGCAAACCACACATTCACTGCGCAT
>probe:Drosophila_2:1633664_at:205:625; Interrogation_Position=1045; Antisense; TGCGCATCCTTGCTGAGTTGCTAAG
>probe:Drosophila_2:1633664_at:75:335; Interrogation_Position=1056; Antisense; GCTGAGTTGCTAAGTTGCTGAGCCA
>probe:Drosophila_2:1633664_at:131:621; Interrogation_Position=1071; Antisense; TGCTGAGCCAACGAAAGCTGCTGAC
>probe:Drosophila_2:1633664_at:628:119; Interrogation_Position=1086; Antisense; AGCTGCTGACATCGGTTGTAATTAC
>probe:Drosophila_2:1633664_at:314:709; Interrogation_Position=1101; Antisense; TTGTAATTACCCTGTCGTGTGCACG
>probe:Drosophila_2:1633664_at:407:509; Interrogation_Position=1119; Antisense; GTGCACGTGCAAAAACTGTATATAC
>probe:Drosophila_2:1633664_at:558:343; Interrogation_Position=1150; Antisense; GCATATAACTTACACCGATCGAAAT
>probe:Drosophila_2:1633664_at:680:289; Interrogation_Position=1238; Antisense; CGGGCGGGCGATTATAACTTATACA
>probe:Drosophila_2:1633664_at:570:59; Interrogation_Position=771; Antisense; ATGTTACCTTCATAATTCTCTTGAT
>probe:Drosophila_2:1633664_at:674:477; Interrogation_Position=848; Antisense; GTTTATACGAAGAAAGCGCTACGAA
>probe:Drosophila_2:1633664_at:171:389; Interrogation_Position=870; Antisense; GAAAACGTATTGTACATCACCCCAC
>probe:Drosophila_2:1633664_at:599:681; Interrogation_Position=933; Antisense; TATCCAACCCACTTGTCAATGCAAC
>probe:Drosophila_2:1633664_at:223:495; Interrogation_Position=947; Antisense; GTCAATGCAACTTACGATTAGTCAT

Paste this into a BLAST search page for me
GGCAAACCACACATTCACTGCGCATTGCGCATCCTTGCTGAGTTGCTAAGGCTGAGTTGCTAAGTTGCTGAGCCATGCTGAGCCAACGAAAGCTGCTGACAGCTGCTGACATCGGTTGTAATTACTTGTAATTACCCTGTCGTGTGCACGGTGCACGTGCAAAAACTGTATATACGCATATAACTTACACCGATCGAAATCGGGCGGGCGATTATAACTTATACAATGTTACCTTCATAATTCTCTTGATGTTTATACGAAGAAAGCGCTACGAAGAAAACGTATTGTACATCACCCCACTATCCAACCCACTTGTCAATGCAACGTCAATGCAACTTACGATTAGTCAT

Full Affymetrix probeset data:

Annotations for 1633664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720