FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633665_at:

>probe:Drosophila_2:1633665_at:228:473; Interrogation_Position=1397; Antisense; GTTAATGGTTAACCCATGGCGCCGC
>probe:Drosophila_2:1633665_at:479:507; Interrogation_Position=1447; Antisense; GTGCCCGTGTAAATTGCCGCCGTCT
>probe:Drosophila_2:1633665_at:522:497; Interrogation_Position=1468; Antisense; GTCTTCTTCTAGCATGCATTTCGTA
>probe:Drosophila_2:1633665_at:406:637; Interrogation_Position=1488; Antisense; TCGTACATGTTGTGTGTGTGTCCCC
>probe:Drosophila_2:1633665_at:653:301; Interrogation_Position=1510; Antisense; CCCCGTCTGTGTGACAGCAAAAGGA
>probe:Drosophila_2:1633665_at:187:613; Interrogation_Position=1548; Antisense; TGAATGGAGTCCAAGGAAACCCCAA
>probe:Drosophila_2:1633665_at:680:179; Interrogation_Position=1573; Antisense; AAACAAACCCAACAGCAATCAGCAA
>probe:Drosophila_2:1633665_at:668:361; Interrogation_Position=1587; Antisense; GCAATCAGCAATAAGCGTCAGCTAA
>probe:Drosophila_2:1633665_at:578:659; Interrogation_Position=1598; Antisense; TAAGCGTCAGCTAATCTAAAGATAC
>probe:Drosophila_2:1633665_at:30:31; Interrogation_Position=1673; Antisense; ATAACCGTTACTAGCAAACCTGCAA
>probe:Drosophila_2:1633665_at:371:683; Interrogation_Position=1698; Antisense; TATGCATAATGCAACAATCGCCTTG
>probe:Drosophila_2:1633665_at:662:235; Interrogation_Position=1713; Antisense; AATCGCCTTGCAACGCTCAAAAATG
>probe:Drosophila_2:1633665_at:322:287; Interrogation_Position=1761; Antisense; CTGGCGATGCTGCTGATGTCTTGAA
>probe:Drosophila_2:1633665_at:6:441; Interrogation_Position=1775; Antisense; GATGTCTTGAAGCATAATACCATTT

Paste this into a BLAST search page for me
GTTAATGGTTAACCCATGGCGCCGCGTGCCCGTGTAAATTGCCGCCGTCTGTCTTCTTCTAGCATGCATTTCGTATCGTACATGTTGTGTGTGTGTCCCCCCCCGTCTGTGTGACAGCAAAAGGATGAATGGAGTCCAAGGAAACCCCAAAAACAAACCCAACAGCAATCAGCAAGCAATCAGCAATAAGCGTCAGCTAATAAGCGTCAGCTAATCTAAAGATACATAACCGTTACTAGCAAACCTGCAATATGCATAATGCAACAATCGCCTTGAATCGCCTTGCAACGCTCAAAAATGCTGGCGATGCTGCTGATGTCTTGAAGATGTCTTGAAGCATAATACCATTT

Full Affymetrix probeset data:

Annotations for 1633665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720