FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633666_at:

>probe:Drosophila_2:1633666_at:551:727; Interrogation_Position=1024; Antisense; TTGGAGGACATGTTCGTCACCGGAC
>probe:Drosophila_2:1633666_at:184:653; Interrogation_Position=1137; Antisense; TAAGGGAAGCTTCACTGTTCACCGT
>probe:Drosophila_2:1633666_at:15:73; Interrogation_Position=1184; Antisense; AGGCATGGTACCGAGTCACCAACTT
>probe:Drosophila_2:1633666_at:519:181; Interrogation_Position=1233; Antisense; AAAAGACTTCCACTTGAGGCTGCCC
>probe:Drosophila_2:1633666_at:121:221; Interrogation_Position=685; Antisense; AAGTGTGACGACGACACCTTCGTTA
>probe:Drosophila_2:1633666_at:12:29; Interrogation_Position=721; Antisense; ATACTGCACTTCCTGCTCGGAGGAA
>probe:Drosophila_2:1633666_at:339:659; Interrogation_Position=764; Antisense; TAACGGCAGGCTTCCATTACGGCAA
>probe:Drosophila_2:1633666_at:606:27; Interrogation_Position=792; Antisense; ATACGAGGTCACTTCGCCGAGGAAA
>probe:Drosophila_2:1633666_at:166:445; Interrogation_Position=837; Antisense; GATGATGTACGGACGCCAGCACTGC
>probe:Drosophila_2:1633666_at:623:687; Interrogation_Position=898; Antisense; TATATGCCATCGTACATGTTTCGGG
>probe:Drosophila_2:1633666_at:6:589; Interrogation_Position=924; Antisense; TGGAGTGTATCCCAGGTACCTGTGC
>probe:Drosophila_2:1633666_at:571:571; Interrogation_Position=955; Antisense; GGCTACTTGCTGTCCATTGATGTGG
>probe:Drosophila_2:1633666_at:497:63; Interrogation_Position=974; Antisense; ATGTGGTCCCACGTCTGTACAAGGC
>probe:Drosophila_2:1633666_at:54:161; Interrogation_Position=992; Antisense; ACAAGGCGTCGCTGGGCACTAGAAT

Paste this into a BLAST search page for me
TTGGAGGACATGTTCGTCACCGGACTAAGGGAAGCTTCACTGTTCACCGTAGGCATGGTACCGAGTCACCAACTTAAAAGACTTCCACTTGAGGCTGCCCAAGTGTGACGACGACACCTTCGTTAATACTGCACTTCCTGCTCGGAGGAATAACGGCAGGCTTCCATTACGGCAAATACGAGGTCACTTCGCCGAGGAAAGATGATGTACGGACGCCAGCACTGCTATATGCCATCGTACATGTTTCGGGTGGAGTGTATCCCAGGTACCTGTGCGGCTACTTGCTGTCCATTGATGTGGATGTGGTCCCACGTCTGTACAAGGCACAAGGCGTCGCTGGGCACTAGAAT

Full Affymetrix probeset data:

Annotations for 1633666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720