FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633667_at:

>probe:Drosophila_2:1633667_at:687:545; Interrogation_Position=1050; Antisense; GGATGCTATTGCCACACCGGAAGGA
>probe:Drosophila_2:1633667_at:651:549; Interrogation_Position=1072; Antisense; GGAGTCCATGCCATATATGCCAGAA
>probe:Drosophila_2:1633667_at:628:149; Interrogation_Position=1154; Antisense; ACTTCCTGATTTCCGGCGATGTTAA
>probe:Drosophila_2:1633667_at:202:189; Interrogation_Position=1214; Antisense; AACAGTTTTTCGATGGGCGCTTGCC
>probe:Drosophila_2:1633667_at:22:325; Interrogation_Position=1230; Antisense; GCGCTTGCCCTACGTAATTGAATGA
>probe:Drosophila_2:1633667_at:69:497; Interrogation_Position=662; Antisense; GTCAGGTGAGATTCGACTCCTTCCA
>probe:Drosophila_2:1633667_at:590:507; Interrogation_Position=688; Antisense; GTGCGGCGCCTCATGAAGTTTATCA
>probe:Drosophila_2:1633667_at:2:659; Interrogation_Position=730; Antisense; TACAAGTTCGAGATCTTTCCACCTG
>probe:Drosophila_2:1633667_at:641:717; Interrogation_Position=746; Antisense; TTCCACCTGGCTACTTTCGAAAAGT
>probe:Drosophila_2:1633667_at:127:209; Interrogation_Position=808; Antisense; AAGCAGTTGGTAGGCAGCGCTCAAA
>probe:Drosophila_2:1633667_at:85:91; Interrogation_Position=866; Antisense; AGTATCTACTGCAAGGCGGTTCTCC
>probe:Drosophila_2:1633667_at:32:165; Interrogation_Position=922; Antisense; AAATCGGGTGATTTCATCTCCTATG
>probe:Drosophila_2:1633667_at:51:39; Interrogation_Position=937; Antisense; ATCTCCTATGACTTTGGGACCGCGG
>probe:Drosophila_2:1633667_at:719:517; Interrogation_Position=985; Antisense; GTGGAGGCCCTCAGTTACAATATAA

Paste this into a BLAST search page for me
GGATGCTATTGCCACACCGGAAGGAGGAGTCCATGCCATATATGCCAGAAACTTCCTGATTTCCGGCGATGTTAAAACAGTTTTTCGATGGGCGCTTGCCGCGCTTGCCCTACGTAATTGAATGAGTCAGGTGAGATTCGACTCCTTCCAGTGCGGCGCCTCATGAAGTTTATCATACAAGTTCGAGATCTTTCCACCTGTTCCACCTGGCTACTTTCGAAAAGTAAGCAGTTGGTAGGCAGCGCTCAAAAGTATCTACTGCAAGGCGGTTCTCCAAATCGGGTGATTTCATCTCCTATGATCTCCTATGACTTTGGGACCGCGGGTGGAGGCCCTCAGTTACAATATAA

Full Affymetrix probeset data:

Annotations for 1633667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720