FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633669_at:

>probe:Drosophila_2:1633669_at:329:213; Interrogation_Position=1030; Antisense; AAGTACTACCTGATCCAAGGGCAAT
>probe:Drosophila_2:1633669_at:479:231; Interrogation_Position=1052; Antisense; AATGTTCCGAGATTTTTGAGCACGT
>probe:Drosophila_2:1633669_at:348:371; Interrogation_Position=1080; Antisense; GAAGGCCACTTCGTGTTACAAGAGA
>probe:Drosophila_2:1633669_at:558:251; Interrogation_Position=1098; Antisense; CAAGAGAGCTCTTCGCTTATCCCGA
>probe:Drosophila_2:1633669_at:514:27; Interrogation_Position=1127; Antisense; ATACCCACCGCGATTTGGAGGCAGA
>probe:Drosophila_2:1633669_at:688:121; Interrogation_Position=1232; Antisense; AGCGCATCTACGTCGACTTTAACGA
>probe:Drosophila_2:1633669_at:477:709; Interrogation_Position=1250; Antisense; TTAACGATCTGCACAGCCGCAAGAT
>probe:Drosophila_2:1633669_at:700:67; Interrogation_Position=1300; Antisense; ATGGCGGATGAAATCACACCACTTT
>probe:Drosophila_2:1633669_at:353:681; Interrogation_Position=1326; Antisense; TATGGCCATGCTTAAGTCGTCTACC
>probe:Drosophila_2:1633669_at:169:303; Interrogation_Position=1364; Antisense; CCTTTTTCAACCTGCGTCAGTGGAA
>probe:Drosophila_2:1633669_at:548:379; Interrogation_Position=1389; Antisense; GAACCGCTGTCGTCCTTTTTGGAAG
>probe:Drosophila_2:1633669_at:719:77; Interrogation_Position=1481; Antisense; AGGATCCTGGTCACGATGTGGCTCC
>probe:Drosophila_2:1633669_at:413:63; Interrogation_Position=1496; Antisense; ATGTGGCTCCCTATGACGATATCGA
>probe:Drosophila_2:1633669_at:434:581; Interrogation_Position=992; Antisense; TGGCCTGCACCGAATATCGATTCGT

Paste this into a BLAST search page for me
AAGTACTACCTGATCCAAGGGCAATAATGTTCCGAGATTTTTGAGCACGTGAAGGCCACTTCGTGTTACAAGAGACAAGAGAGCTCTTCGCTTATCCCGAATACCCACCGCGATTTGGAGGCAGAAGCGCATCTACGTCGACTTTAACGATTAACGATCTGCACAGCCGCAAGATATGGCGGATGAAATCACACCACTTTTATGGCCATGCTTAAGTCGTCTACCCCTTTTTCAACCTGCGTCAGTGGAAGAACCGCTGTCGTCCTTTTTGGAAGAGGATCCTGGTCACGATGTGGCTCCATGTGGCTCCCTATGACGATATCGATGGCCTGCACCGAATATCGATTCGT

Full Affymetrix probeset data:

Annotations for 1633669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720