FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633672_at:

>probe:Drosophila_2:1633672_at:182:355; Interrogation_Position=1006; Antisense; GCAAGGTTTCGGCTATGGTTCCAAT
>probe:Drosophila_2:1633672_at:524:9; Interrogation_Position=1029; Antisense; ATTCCTATTACAACGCTCAATCGAC
>probe:Drosophila_2:1633672_at:82:685; Interrogation_Position=1067; Antisense; TATCCTCCGACTGGTTTTCCGATGT
>probe:Drosophila_2:1633672_at:300:443; Interrogation_Position=1087; Antisense; GATGTCCCAGCAGTCAGGCTTCATG
>probe:Drosophila_2:1633672_at:559:233; Interrogation_Position=1126; Antisense; AATGCCGACGGCTAATGGTTCAAAT
>probe:Drosophila_2:1633672_at:691:115; Interrogation_Position=1200; Antisense; AGCATCCTTGCTGGCCGGTATATAT
>probe:Drosophila_2:1633672_at:289:603; Interrogation_Position=1248; Antisense; TGTTCGGTGAGCCACAGGACGCCAA
>probe:Drosophila_2:1633672_at:513:49; Interrogation_Position=1272; Antisense; ATGCCAGCTGCTCTCGTAATTCAAA
>probe:Drosophila_2:1633672_at:610:97; Interrogation_Position=809; Antisense; AGAGGCTCTGCCTTGGGTGCCGATA
>probe:Drosophila_2:1633672_at:68:523; Interrogation_Position=838; Antisense; GGGCCATCCTCAATCGATTGCGGGT
>probe:Drosophila_2:1633672_at:713:559; Interrogation_Position=863; Antisense; GGAACGAATTCTCGCCGGAAGGATT
>probe:Drosophila_2:1633672_at:155:547; Interrogation_Position=895; Antisense; GGAGGAGGCCTTCATGACCGTAATC
>probe:Drosophila_2:1633672_at:443:249; Interrogation_Position=922; Antisense; CAATCTGCGCGAAAATTATCCGGGC
>probe:Drosophila_2:1633672_at:692:453; Interrogation_Position=989; Antisense; GATAACTACCAATCGGCGCAAGGTT

Paste this into a BLAST search page for me
GCAAGGTTTCGGCTATGGTTCCAATATTCCTATTACAACGCTCAATCGACTATCCTCCGACTGGTTTTCCGATGTGATGTCCCAGCAGTCAGGCTTCATGAATGCCGACGGCTAATGGTTCAAATAGCATCCTTGCTGGCCGGTATATATTGTTCGGTGAGCCACAGGACGCCAAATGCCAGCTGCTCTCGTAATTCAAAAGAGGCTCTGCCTTGGGTGCCGATAGGGCCATCCTCAATCGATTGCGGGTGGAACGAATTCTCGCCGGAAGGATTGGAGGAGGCCTTCATGACCGTAATCCAATCTGCGCGAAAATTATCCGGGCGATAACTACCAATCGGCGCAAGGTT

Full Affymetrix probeset data:

Annotations for 1633672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720